ID: 1048141530

View in Genome Browser
Species Human (GRCh38)
Location 8:131799554-131799576
Sequence GAGGAAACTGAGCTCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048141530_1048141537 25 Left 1048141530 8:131799554-131799576 CCTCCCAGGAGCTCAGTTTCCTC No data
Right 1048141537 8:131799602-131799624 GACATCTATGGGCCTTTTCAAGG No data
1048141530_1048141535 14 Left 1048141530 8:131799554-131799576 CCTCCCAGGAGCTCAGTTTCCTC No data
Right 1048141535 8:131799591-131799613 ACCTTGATCTAGACATCTATGGG No data
1048141530_1048141534 13 Left 1048141530 8:131799554-131799576 CCTCCCAGGAGCTCAGTTTCCTC No data
Right 1048141534 8:131799590-131799612 AACCTTGATCTAGACATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048141530 Original CRISPR GAGGAAACTGAGCTCCTGGG AGG (reversed) Intergenic