ID: 1048141535

View in Genome Browser
Species Human (GRCh38)
Location 8:131799591-131799613
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048141529_1048141535 15 Left 1048141529 8:131799553-131799575 CCCTCCCAGGAGCTCAGTTTCCT No data
Right 1048141535 8:131799591-131799613 ACCTTGATCTAGACATCTATGGG No data
1048141530_1048141535 14 Left 1048141530 8:131799554-131799576 CCTCCCAGGAGCTCAGTTTCCTC No data
Right 1048141535 8:131799591-131799613 ACCTTGATCTAGACATCTATGGG No data
1048141531_1048141535 11 Left 1048141531 8:131799557-131799579 CCCAGGAGCTCAGTTTCCTCACT No data
Right 1048141535 8:131799591-131799613 ACCTTGATCTAGACATCTATGGG No data
1048141533_1048141535 -5 Left 1048141533 8:131799573-131799595 CCTCACTTTAAAATGAGAACCTT No data
Right 1048141535 8:131799591-131799613 ACCTTGATCTAGACATCTATGGG No data
1048141532_1048141535 10 Left 1048141532 8:131799558-131799580 CCAGGAGCTCAGTTTCCTCACTT No data
Right 1048141535 8:131799591-131799613 ACCTTGATCTAGACATCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048141535 Original CRISPR ACCTTGATCTAGACATCTAT GGG Intergenic