ID: 1048141992

View in Genome Browser
Species Human (GRCh38)
Location 8:131803719-131803741
Sequence CAGTCTGAGCACTGAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048141992_1048141998 26 Left 1048141992 8:131803719-131803741 CCTGTGTCTCAGTGCTCAGACTG No data
Right 1048141998 8:131803768-131803790 TTAGCTGAATATGGAGGAGGAGG No data
1048141992_1048141995 17 Left 1048141992 8:131803719-131803741 CCTGTGTCTCAGTGCTCAGACTG No data
Right 1048141995 8:131803759-131803781 CAGAAGTTCTTAGCTGAATATGG No data
1048141992_1048141994 -7 Left 1048141992 8:131803719-131803741 CCTGTGTCTCAGTGCTCAGACTG No data
Right 1048141994 8:131803735-131803757 CAGACTGTGATGTGGAAAAAAGG No data
1048141992_1048141999 27 Left 1048141992 8:131803719-131803741 CCTGTGTCTCAGTGCTCAGACTG No data
Right 1048141999 8:131803769-131803791 TAGCTGAATATGGAGGAGGAGGG No data
1048141992_1048141997 23 Left 1048141992 8:131803719-131803741 CCTGTGTCTCAGTGCTCAGACTG No data
Right 1048141997 8:131803765-131803787 TTCTTAGCTGAATATGGAGGAGG No data
1048141992_1048141996 20 Left 1048141992 8:131803719-131803741 CCTGTGTCTCAGTGCTCAGACTG No data
Right 1048141996 8:131803762-131803784 AAGTTCTTAGCTGAATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048141992 Original CRISPR CAGTCTGAGCACTGAGACAC AGG (reversed) Intergenic
No off target data available for this crispr