ID: 1048145753

View in Genome Browser
Species Human (GRCh38)
Location 8:131841372-131841394
Sequence AGAGCCCCTAGAACTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048145753_1048145757 22 Left 1048145753 8:131841372-131841394 CCCCAGGGAGTTCTAGGGGCTCT No data
Right 1048145757 8:131841417-131841439 TTTGCACCTAATTAGGTTAAAGG No data
1048145753_1048145758 25 Left 1048145753 8:131841372-131841394 CCCCAGGGAGTTCTAGGGGCTCT No data
Right 1048145758 8:131841420-131841442 GCACCTAATTAGGTTAAAGGCGG No data
1048145753_1048145756 15 Left 1048145753 8:131841372-131841394 CCCCAGGGAGTTCTAGGGGCTCT No data
Right 1048145756 8:131841410-131841432 CTAGCACTTTGCACCTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048145753 Original CRISPR AGAGCCCCTAGAACTCCCTG GGG (reversed) Intergenic
No off target data available for this crispr