ID: 1048145758

View in Genome Browser
Species Human (GRCh38)
Location 8:131841420-131841442
Sequence GCACCTAATTAGGTTAAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048145754_1048145758 24 Left 1048145754 8:131841373-131841395 CCCAGGGAGTTCTAGGGGCTCTA No data
Right 1048145758 8:131841420-131841442 GCACCTAATTAGGTTAAAGGCGG No data
1048145752_1048145758 28 Left 1048145752 8:131841369-131841391 CCACCCCAGGGAGTTCTAGGGGC No data
Right 1048145758 8:131841420-131841442 GCACCTAATTAGGTTAAAGGCGG No data
1048145755_1048145758 23 Left 1048145755 8:131841374-131841396 CCAGGGAGTTCTAGGGGCTCTAC No data
Right 1048145758 8:131841420-131841442 GCACCTAATTAGGTTAAAGGCGG No data
1048145753_1048145758 25 Left 1048145753 8:131841372-131841394 CCCCAGGGAGTTCTAGGGGCTCT No data
Right 1048145758 8:131841420-131841442 GCACCTAATTAGGTTAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048145758 Original CRISPR GCACCTAATTAGGTTAAAGG CGG Intergenic
No off target data available for this crispr