ID: 1048147303

View in Genome Browser
Species Human (GRCh38)
Location 8:131857978-131858000
Sequence ATGGAGAAGGAGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048147303_1048147309 22 Left 1048147303 8:131857978-131858000 CCTTCTTTCTTCTCCTTCTCCAT No data
Right 1048147309 8:131858023-131858045 GTATTATCCGTCTATAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048147303 Original CRISPR ATGGAGAAGGAGAAGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr