ID: 1048148303

View in Genome Browser
Species Human (GRCh38)
Location 8:131867491-131867513
Sequence CTGTGGGCTTGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048148303_1048148315 14 Left 1048148303 8:131867491-131867513 CCTTCCTCCCTCCAAGCCCACAG No data
Right 1048148315 8:131867528-131867550 ACTATATGCAATGAACTGGATGG No data
1048148303_1048148309 -9 Left 1048148303 8:131867491-131867513 CCTTCCTCCCTCCAAGCCCACAG No data
Right 1048148309 8:131867505-131867527 AGCCCACAGCCCTCATAACTGGG No data
1048148303_1048148314 10 Left 1048148303 8:131867491-131867513 CCTTCCTCCCTCCAAGCCCACAG No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148303_1048148308 -10 Left 1048148303 8:131867491-131867513 CCTTCCTCCCTCCAAGCCCACAG No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048148303 Original CRISPR CTGTGGGCTTGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr