ID: 1048148308

View in Genome Browser
Species Human (GRCh38)
Location 8:131867504-131867526
Sequence AAGCCCACAGCCCTCATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048148293_1048148308 21 Left 1048148293 8:131867460-131867482 CCCCAGGTTTTCCTCCCCTCCTG No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148300_1048148308 5 Left 1048148300 8:131867476-131867498 CCTCCTGGCTCACCACCTTCCTC No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148301_1048148308 2 Left 1048148301 8:131867479-131867501 CCTGGCTCACCACCTTCCTCCCT No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148302_1048148308 -7 Left 1048148302 8:131867488-131867510 CCACCTTCCTCCCTCCAAGCCCA No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148294_1048148308 20 Left 1048148294 8:131867461-131867483 CCCAGGTTTTCCTCCCCTCCTGG No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148303_1048148308 -10 Left 1048148303 8:131867491-131867513 CCTTCCTCCCTCCAAGCCCACAG No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148297_1048148308 10 Left 1048148297 8:131867471-131867493 CCTCCCCTCCTGGCTCACCACCT No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148296_1048148308 19 Left 1048148296 8:131867462-131867484 CCAGGTTTTCCTCCCCTCCTGGC No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148299_1048148308 6 Left 1048148299 8:131867475-131867497 CCCTCCTGGCTCACCACCTTCCT No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data
1048148298_1048148308 7 Left 1048148298 8:131867474-131867496 CCCCTCCTGGCTCACCACCTTCC No data
Right 1048148308 8:131867504-131867526 AAGCCCACAGCCCTCATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048148308 Original CRISPR AAGCCCACAGCCCTCATAAC TGG Intergenic
No off target data available for this crispr