ID: 1048148314

View in Genome Browser
Species Human (GRCh38)
Location 8:131867524-131867546
Sequence TGGGACTATATGCAATGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048148302_1048148314 13 Left 1048148302 8:131867488-131867510 CCACCTTCCTCCCTCCAAGCCCA No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148305_1048148314 3 Left 1048148305 8:131867498-131867520 CCCTCCAAGCCCACAGCCCTCAT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148301_1048148314 22 Left 1048148301 8:131867479-131867501 CCTGGCTCACCACCTTCCTCCCT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148306_1048148314 2 Left 1048148306 8:131867499-131867521 CCTCCAAGCCCACAGCCCTCATA No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148307_1048148314 -1 Left 1048148307 8:131867502-131867524 CCAAGCCCACAGCCCTCATAACT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148304_1048148314 6 Left 1048148304 8:131867495-131867517 CCTCCCTCCAAGCCCACAGCCCT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148311_1048148314 -7 Left 1048148311 8:131867508-131867530 CCACAGCCCTCATAACTGGGACT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148299_1048148314 26 Left 1048148299 8:131867475-131867497 CCCTCCTGGCTCACCACCTTCCT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148298_1048148314 27 Left 1048148298 8:131867474-131867496 CCCCTCCTGGCTCACCACCTTCC No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148303_1048148314 10 Left 1048148303 8:131867491-131867513 CCTTCCTCCCTCCAAGCCCACAG No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148297_1048148314 30 Left 1048148297 8:131867471-131867493 CCTCCCCTCCTGGCTCACCACCT No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148310_1048148314 -6 Left 1048148310 8:131867507-131867529 CCCACAGCCCTCATAACTGGGAC No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data
1048148300_1048148314 25 Left 1048148300 8:131867476-131867498 CCTCCTGGCTCACCACCTTCCTC No data
Right 1048148314 8:131867524-131867546 TGGGACTATATGCAATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048148314 Original CRISPR TGGGACTATATGCAATGAAC TGG Intergenic
No off target data available for this crispr