ID: 1048151432

View in Genome Browser
Species Human (GRCh38)
Location 8:131899040-131899062
Sequence ATGTACCGCAAGAAGCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048151427_1048151432 8 Left 1048151427 8:131899009-131899031 CCACAGTTACTGGGAGTCCCCAA No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data
1048151426_1048151432 11 Left 1048151426 8:131899006-131899028 CCACCACAGTTACTGGGAGTCCC No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data
1048151421_1048151432 24 Left 1048151421 8:131898993-131899015 CCCTCCTTAGGATCCACCACAGT No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data
1048151428_1048151432 -9 Left 1048151428 8:131899026-131899048 CCCCAATATCTGCTATGTACCGC No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data
1048151429_1048151432 -10 Left 1048151429 8:131899027-131899049 CCCAATATCTGCTATGTACCGCA No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data
1048151423_1048151432 20 Left 1048151423 8:131898997-131899019 CCTTAGGATCCACCACAGTTACT No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data
1048151422_1048151432 23 Left 1048151422 8:131898994-131899016 CCTCCTTAGGATCCACCACAGTT No data
Right 1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048151432 Original CRISPR ATGTACCGCAAGAAGCACTA GGG Intergenic
No off target data available for this crispr