ID: 1048152528

View in Genome Browser
Species Human (GRCh38)
Location 8:131907998-131908020
Sequence TTAATGATTATGTAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048152524_1048152528 3 Left 1048152524 8:131907972-131907994 CCCACTTGTGGGGACATGGGGCT 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG No data
1048152523_1048152528 4 Left 1048152523 8:131907971-131907993 CCCCACTTGTGGGGACATGGGGC 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG No data
1048152525_1048152528 2 Left 1048152525 8:131907973-131907995 CCACTTGTGGGGACATGGGGCTA 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG No data
1048152516_1048152528 27 Left 1048152516 8:131907948-131907970 CCAGATCTCATCTTTCAGTCTGT 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG No data
1048152515_1048152528 28 Left 1048152515 8:131907947-131907969 CCCAGATCTCATCTTTCAGTCTG 0: 1
1: 0
2: 1
3: 18
4: 305
Right 1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048152528 Original CRISPR TTAATGATTATGTAGGTGGT AGG Intronic
No off target data available for this crispr