ID: 1048159250

View in Genome Browser
Species Human (GRCh38)
Location 8:131997456-131997478
Sequence CTATGTAATGGGAAGTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048159250_1048159253 10 Left 1048159250 8:131997456-131997478 CCATTCAACTTCCCATTACATAG 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1048159253 8:131997489-131997511 TTATTAAGAACTTATCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048159250 Original CRISPR CTATGTAATGGGAAGTTGAA TGG (reversed) Intronic
904443530 1:30549629-30549651 CTCTGTAATGGGAGATTGCACGG - Intergenic
909176143 1:72362584-72362606 CTCTGGCATGAGAAGTTGAAAGG - Intergenic
909658958 1:78061433-78061455 ATGTGGAGTGGGAAGTTGAAGGG + Intronic
911361926 1:96887227-96887249 CTATGGACTGGTAAGTAGAAAGG + Intergenic
911445897 1:97991249-97991271 ATATTTAATGAGAAATTGAAAGG - Intergenic
912532650 1:110337937-110337959 CTATGGAAAGGAAAGTTGTACGG + Intergenic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
918891601 1:190279384-190279406 CTATGTGATGGGACATAGAAAGG - Intronic
919348791 1:196421279-196421301 CTTTGTAATGTGAATTTGGAAGG - Intronic
921395953 1:214669849-214669871 CTCTCTACTGGGAAGTTGTACGG - Intergenic
1063596050 10:7436625-7436647 CTATTTTATAGGAAGTGGAAAGG - Intergenic
1064753652 10:18556214-18556236 GAATGCAATGGGAAGTGGAATGG + Intronic
1065134856 10:22657528-22657550 CTTTGGAATAGGGAGTTGAAAGG - Intronic
1065784289 10:29199004-29199026 CAATGTAAAGGGAAATTGCAAGG - Intergenic
1065932441 10:30491555-30491577 TTATGTAATGACAAGTTGTAAGG + Intergenic
1067455261 10:46414580-46414602 CACTTTAATGGGAAGCTGAAAGG - Intergenic
1067631941 10:47970054-47970076 TTCTTTAATGGGAAGCTGAAAGG + Intergenic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1071913157 10:90258516-90258538 ATATGGAATGGGAAGGAGAAGGG + Intergenic
1074099896 10:110346588-110346610 TTAATTAATGGGAGGTTGAAAGG - Intergenic
1074347749 10:112704702-112704724 CTCTCTAATTGGTAGTTGAATGG + Intronic
1074910015 10:117899928-117899950 CTATTGAATGGGAAGATGGAAGG - Intergenic
1074974858 10:118571929-118571951 CTATCTAGTGGCAGGTTGAATGG - Intergenic
1075583773 10:123642877-123642899 CTGAGCAATGGGAAGTTCAAAGG + Intergenic
1079785603 11:24667557-24667579 CTGTGTAATGGGGAGCTGAGTGG + Intronic
1080496359 11:32824234-32824256 ATATAAAATGGGAAGTTGATGGG - Intergenic
1081251679 11:40843301-40843323 CTATGTACTAGGTAGTTGACTGG + Intronic
1086998530 11:93388613-93388635 CTATGTCATGAGAAGTCTAAGGG - Intronic
1087638154 11:100726557-100726579 CTATGTAATGCAAATTTCAAAGG + Intronic
1088149604 11:106727874-106727896 CTGTGTATTGGAAATTTGAAGGG - Intronic
1088158103 11:106833805-106833827 CTTTGTAATGGAAAATTGAAGGG - Intronic
1089194874 11:116688356-116688378 CTAAGTATTGGGAGGGTGAAGGG - Intergenic
1089835379 11:121365809-121365831 CTCTGTAAACGGCAGTTGAAAGG + Intergenic
1092845885 12:12584793-12584815 TATTGTAATGGGAAGTTTAATGG - Intergenic
1092948455 12:13478012-13478034 CTATGTAAAAGGATGTGGAAAGG + Intergenic
1093640322 12:21520110-21520132 CTAAGGAATGTGAAGTAGAAAGG - Intergenic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1108455586 13:50610557-50610579 CAATGTAATGCGAAGGTGAAGGG - Intronic
1110261863 13:73493734-73493756 CTTTATAATGGGAAAATGAAGGG + Intergenic
1110646096 13:77886248-77886270 CTATATAATGGGAAGAAAAAAGG + Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1114467047 14:22930551-22930573 CTGTGTAATAGAAAGTTGGATGG + Intergenic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1116736964 14:48703378-48703400 CTATGGAATGTGAAGTAGAAAGG + Intergenic
1116787318 14:49301944-49301966 CTCTGGAATGGGAGGTTGATTGG - Intergenic
1118919702 14:70138967-70138989 ATATTTAATGGGATGTTGGATGG + Intronic
1119782735 14:77288549-77288571 CTAGGAAATGGGAAATTGAAAGG + Intronic
1119905960 14:78302199-78302221 CTATTTTATGGGATGTTGTAGGG - Intronic
1125907613 15:43407943-43407965 CTTTGTTATGGGCACTTGAATGG + Exonic
1126976476 15:54187565-54187587 CTATGCAAAGGGAGGTAGAAAGG - Intronic
1130785649 15:87093014-87093036 CTTTGTAATTTGAAGTTTAATGG + Intergenic
1131053655 15:89363281-89363303 CTCTGAAATGGGAAGTTGTTGGG + Intergenic
1131057252 15:89382855-89382877 CTATGTATTTGGAAACTGAAGGG + Intergenic
1131799665 15:96055867-96055889 CTATGTAATGGGGAGGCAAAAGG + Intergenic
1134210529 16:12272576-12272598 CTATGTAATCAGAATTTGAGGGG - Intronic
1134584603 16:15398936-15398958 CAATGAAAGGGGAAGTGGAAGGG + Intronic
1135008417 16:18849752-18849774 CCAAGAAATGGGAAGCTGAAAGG - Intronic
1136082834 16:27863930-27863952 TCATGTAATGGAAAGTTGTAGGG + Intronic
1137577395 16:49609410-49609432 TTATCTAATGGGGAGTTTAAAGG + Intronic
1139223821 16:65214481-65214503 AAATGTAATGAGAAGTTGAAAGG - Intergenic
1143843091 17:9750322-9750344 ATATGTACTGGGCAGTGGAATGG + Intergenic
1145697551 17:26801058-26801080 CAATGGAATGGAAAGTAGAATGG + Intergenic
1146769337 17:35554217-35554239 ATATGTTATGAGAAGTTGGAAGG + Intronic
1149722366 17:58859157-58859179 CTATGTTATGGCAATTTGATTGG + Intronic
1151481589 17:74372795-74372817 CTATTTCCTGGGAAGATGAAAGG + Intergenic
1154108972 18:11549825-11549847 TTATGTACTGGGCAGTTGATGGG - Intergenic
1156062183 18:33092251-33092273 TTCTGTAATGGTAAGTGGAAAGG - Intronic
1156112837 18:33748032-33748054 CTCTGTAATCTGAAGTTAAATGG - Exonic
1159582876 18:70252293-70252315 TTATACAATGGGAATTTGAATGG + Intergenic
1160214048 18:76911081-76911103 CTATGTAATAACACGTTGAAAGG + Intronic
1160668086 19:342842-342864 CTCTGAAATGGGAAGTTTAATGG - Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1165621539 19:37252378-37252400 TTATTTAGTGGGATGTTGAAGGG + Intergenic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1168446365 19:56418778-56418800 CTATATAATGTGTAATTGAAGGG + Intronic
925688669 2:6497650-6497672 TTATGAAAAGGGAAGTTCAAAGG + Intergenic
925964867 2:9055141-9055163 CTATGTACTTGGGAGTTGGAAGG + Intergenic
929020625 2:37548795-37548817 TTTTGTAATAGGATGTTGAATGG - Intergenic
929697805 2:44134151-44134173 ATAGGTAATGGGAGGGTGAAAGG + Intergenic
930430847 2:51274104-51274126 CTATGGGATGGGAAGGTGTAAGG + Intergenic
930485251 2:52003565-52003587 CTATGTCGTGGGAACTAGAATGG + Intergenic
930649340 2:53948906-53948928 CTATAAAAGGGGAAGTTCAATGG + Intronic
934395967 2:93145234-93145256 CTATGAAAGGGAAAGTTCAACGG - Intergenic
935290353 2:101604928-101604950 CTATGGAAAGGCAAGATGAAGGG - Intergenic
940570532 2:155427325-155427347 CTTTCTAATGGGAAGTTTTATGG + Intergenic
942711480 2:178840928-178840950 ATGTTTAATGGGAAGTTAAATGG - Intronic
942800104 2:179864813-179864835 ATATGTATTTGGAAGGTGAAAGG + Intergenic
942856401 2:180555059-180555081 ATAGGTTATGGGAAGTAGAATGG + Intergenic
945369038 2:208993903-208993925 TTTTGTAATTGGAGGTTGAATGG + Intergenic
947318665 2:228893238-228893260 ATATGCTATGGGAAATTGAAAGG - Intronic
1171505446 20:25629430-25629452 CTCTGTACTGGGAAGTTAAAAGG + Intergenic
1174998668 20:55601525-55601547 CTAAGTATTGGGAAGTTGCCAGG - Intergenic
1176990659 21:15492231-15492253 TTATTTAATGGGAAATTTAATGG + Intergenic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
949668224 3:6366403-6366425 CTATTTAATGCTAAGTTGTAAGG + Intergenic
950945581 3:16942405-16942427 AAAGGTAATGGGAAGTTGATAGG - Intronic
957692940 3:83595984-83596006 ATAAGTAATGAGAAGCTGAATGG + Intergenic
957910607 3:86616841-86616863 CAATGACCTGGGAAGTTGAAGGG - Intergenic
960303299 3:116030801-116030823 CTATGTGAAAGGAAGTTGCATGG + Intronic
961220267 3:125193984-125194006 CTATGTAATAGGATGTTGAATGG - Intronic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962283964 3:134071511-134071533 CTATGTCTGAGGAAGTTGAAAGG + Intronic
963124543 3:141803044-141803066 CTAGGTAATGGGTATTTCAAAGG - Intronic
963591253 3:147262379-147262401 ATTTGTTATGGGAATTTGAAAGG - Intergenic
964163737 3:153675986-153676008 CTATGAGATGGGAAGTTGTAGGG + Intergenic
965146235 3:164908360-164908382 TTATGTTTTGGGAAATTGAAGGG - Intergenic
965816490 3:172641937-172641959 ATAAGTGATGGGAAGTAGAAGGG - Intronic
966997713 3:185300032-185300054 CTTAGAAATGGGAAGTAGAATGG - Intronic
967352135 3:188525524-188525546 CTATGTAAGGTTAAGGTGAAGGG + Intronic
967476201 3:189923248-189923270 CTATGTATTGTGAAGTTCAATGG - Intergenic
972655860 4:41063176-41063198 CTATGTAGAAGAAAGTTGAAGGG - Intronic
972942497 4:44214051-44214073 CTAAATTATGGGAAGGTGAAGGG - Intronic
974243705 4:59285769-59285791 ATAGGAAATGGGAATTTGAAAGG - Intergenic
975001613 4:69230367-69230389 CTATGTAATAGTATGGTGAAGGG + Intergenic
975003830 4:69261750-69261772 CTATGTAATAGTATGGTGAAGGG - Intergenic
975012190 4:69370257-69370279 CTATGTAATAGTATGGTGAAGGG - Intronic
975927133 4:79470642-79470664 CATAGAAATGGGAAGTTGAATGG - Intergenic
979098807 4:116588772-116588794 GTATTTAATGGCAAGATGAAGGG - Intergenic
979781413 4:124655185-124655207 GTATGGAAGGTGAAGTTGAATGG + Intergenic
980265271 4:130507062-130507084 CCAAATAATGGGAATTTGAAGGG - Intergenic
981754066 4:148122089-148122111 CTATTTGATGGGAGGTTGAATGG + Intronic
982402464 4:154983413-154983435 CTGTGTCCTGGGACGTTGAAAGG + Intergenic
983408411 4:167363361-167363383 CTGTGTAATGGAAAGTAGATAGG + Intergenic
984175488 4:176411747-176411769 TTAGGTAGTGGGAAGTAGAAGGG - Intergenic
984242920 4:177239343-177239365 CTATAAAATGGGAGGATGAATGG + Intergenic
984871199 4:184326782-184326804 GTAAGTTATGGGAAGGTGAAGGG - Intergenic
985425671 4:189828156-189828178 CCATTAAATGGAAAGTTGAAAGG - Intergenic
986921973 5:12696058-12696080 TTAAATAATGGGAAGGTGAAAGG + Intergenic
987128741 5:14840862-14840884 CTATGGAAAGGGAAAATGAACGG + Intronic
987242460 5:16014679-16014701 CTCTATAAAGGGATGTTGAAGGG - Intergenic
988728893 5:33950565-33950587 CTAGGTAAAGGGAAGGGGAAGGG + Intronic
989129405 5:38091589-38091611 CTATATATTGGTAAGTTTAAAGG + Intergenic
989697764 5:44223908-44223930 CTTTTTAATGTGAAGTTGTAGGG - Intergenic
990782530 5:59382051-59382073 GCATGTAATGAGAGGTTGAAAGG - Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
996328717 5:122306589-122306611 ATAGAGAATGGGAAGTTGAAGGG + Intergenic
997988144 5:138520981-138521003 GTATGTAATTGAAAGTAGAATGG - Intronic
1003517586 6:6830317-6830339 TTATGAAATGGGAAGTAGAGAGG - Intergenic
1003980948 6:11389334-11389356 TGATGTGATGGGAAGGTGAAGGG - Intergenic
1004842698 6:19605572-19605594 CTATAGATTGGGAAGTTCAAGGG + Intergenic
1005575459 6:27185433-27185455 CTATGTAATGTGCAGGTCAAAGG - Intergenic
1007972502 6:46067022-46067044 CTTTGTAATGGGACGCTCAAAGG + Intronic
1008166390 6:48143911-48143933 CTACGTACTGGGAAGATGAAGGG - Intergenic
1009399698 6:63239756-63239778 CTTTGTAGTTGGAAGTTGAGTGG + Intergenic
1010525843 6:76899462-76899484 ATATGTAGTGGGAAATAGAAGGG + Intergenic
1010821909 6:80424200-80424222 CTATTTAGTGAGAAGTTGAGAGG + Intergenic
1011050342 6:83141115-83141137 CTATGTAATGAAACATTGAAAGG - Intronic
1012737780 6:102973240-102973262 CTGTCTAATAGGAAGTTTAATGG + Intergenic
1013058966 6:106613159-106613181 CTAGCTAAAGGGAAGTTGATTGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013542388 6:111123368-111123390 GTAAGTAATGAGAGGTTGAAAGG - Intronic
1013904064 6:115194249-115194271 CTATTTACTGGAAAGTAGAATGG + Intergenic
1014298282 6:119648036-119648058 CTTGATAAAGGGAAGTTGAAAGG + Intergenic
1022770134 7:33461856-33461878 ATATGTCATGTGAAGTTAAAAGG - Intronic
1023803617 7:43855612-43855634 CCATGTAATGGGATGTTCACAGG - Intergenic
1028386074 7:90254562-90254584 CAATGTGATGGGAATTTTAATGG + Intronic
1028895937 7:96041758-96041780 TTATATAATTAGAAGTTGAAAGG + Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1039369139 8:36966941-36966963 CTCTGTAATCAGAAGATGAAGGG - Intergenic
1040643199 8:49365840-49365862 CTTTTTAATAGGAAGTTGATAGG + Intergenic
1040847294 8:51857090-51857112 CTTTGTCATGGGACGTTAAATGG - Intronic
1042314873 8:67415040-67415062 TTTTGCAATGGGAAATTGAAAGG - Intergenic
1043549485 8:81353873-81353895 CTCTGTAATGGGAAGTTTTAGGG - Intergenic
1046140804 8:110088622-110088644 CTATCTCATGAGAAATTGAAGGG - Intergenic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1047123349 8:121931164-121931186 AAAAGTAAGGGGAAGTTGAAGGG + Intergenic
1047475097 8:125220012-125220034 TTATATAATGGGAAGTTCATTGG + Intronic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1051718994 9:20015879-20015901 TTATGTAATGGGATGTTAAGTGG - Intergenic
1052166456 9:25336191-25336213 CTTGGTATTGGGAACTTGAAAGG + Intergenic
1052268175 9:26598036-26598058 CTGTGTAATGATAATTTGAATGG - Intergenic
1052365343 9:27606469-27606491 CTTTGTAATGGTAAGGAGAAAGG - Intergenic
1052668902 9:31530121-31530143 ATTTGTAATGGAAAGTAGAACGG + Intergenic
1056266616 9:84903022-84903044 CCATGTAATTTGAAGATGAAAGG + Intronic
1059624014 9:116041364-116041386 TTATACAATGGGAAATTGAATGG - Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1189957899 X:46294899-46294921 CTGAGTAATGGTAAGTGGAACGG - Intergenic
1190947981 X:55114461-55114483 ATATGTAATGGCAAGGGGAAGGG + Intronic
1194046124 X:89005692-89005714 CTATGAAAGGGGAACTTGTAAGG - Intergenic
1194149256 X:90303094-90303116 TTAAGTAATGTGAACTTGAAAGG + Intergenic
1195069312 X:101263971-101263993 CTATGTGAAGGGAAATTGGATGG - Exonic
1196409702 X:115402541-115402563 CCATGTAATGAGAAGTCCAAAGG - Intergenic
1200495629 Y:3879827-3879849 TTAAGTAATGTGAACTTGAAAGG + Intergenic
1200840024 Y:7772302-7772324 CTATGTGGTGGGAAGTTAGAGGG - Intergenic
1201101618 Y:10679648-10679670 CTATGGAGTGGAAAGTTAAAAGG - Intergenic