ID: 1048161628

View in Genome Browser
Species Human (GRCh38)
Location 8:132026849-132026871
Sequence GGTTTCTTGGGCTCATGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048161622_1048161628 17 Left 1048161622 8:132026809-132026831 CCCTATAGGAAAAAATGGAAATG 0: 1
1: 0
2: 4
3: 52
4: 592
Right 1048161628 8:132026849-132026871 GGTTTCTTGGGCTCATGATCTGG No data
1048161619_1048161628 24 Left 1048161619 8:132026802-132026824 CCTCATCCCCTATAGGAAAAAAT 0: 1
1: 0
2: 1
3: 32
4: 293
Right 1048161628 8:132026849-132026871 GGTTTCTTGGGCTCATGATCTGG No data
1048161623_1048161628 16 Left 1048161623 8:132026810-132026832 CCTATAGGAAAAAATGGAAATGC 0: 1
1: 0
2: 2
3: 49
4: 473
Right 1048161628 8:132026849-132026871 GGTTTCTTGGGCTCATGATCTGG No data
1048161621_1048161628 18 Left 1048161621 8:132026808-132026830 CCCCTATAGGAAAAAATGGAAAT 0: 1
1: 0
2: 7
3: 37
4: 423
Right 1048161628 8:132026849-132026871 GGTTTCTTGGGCTCATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048161628 Original CRISPR GGTTTCTTGGGCTCATGATC TGG Intronic
No off target data available for this crispr