ID: 1048162051

View in Genome Browser
Species Human (GRCh38)
Location 8:132030486-132030508
Sequence TTGAACCCCTTGGGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048162051_1048162054 0 Left 1048162051 8:132030486-132030508 CCACTTTTTCCCAAGGGGTTCAA 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1048162054 8:132030509-132030531 CAGAATACAGAAACTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048162051 Original CRISPR TTGAACCCCTTGGGAAAAAG TGG (reversed) Intronic
903404951 1:23088444-23088466 TTGAGCCCATTGGGCAAATGAGG + Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
911948073 1:104137107-104137129 TAGCACCCCTTTGAAAAAAGGGG + Intergenic
912018396 1:105071922-105071944 TAGAACCCCTTGTGGAACAGTGG - Intergenic
912930851 1:113959523-113959545 ATGAAACTCTTCGGAAAAAGTGG - Intronic
913640261 1:120806026-120806048 TTGAGCCCCTTGGAGAAAACAGG - Intronic
914278215 1:146144312-146144334 TTGAGCCCCTTGGAGAAAACAGG + Intronic
914539263 1:148595260-148595282 TTGAGCCCCTTGGAGAAAACAGG + Intronic
914627417 1:149476368-149476390 TTGAGCCCCTTGGAGAAAACAGG - Intergenic
916171384 1:162003828-162003850 GTGAACCCCATGCCAAAAAGCGG - Intronic
916266085 1:162891066-162891088 TTGAACACTTTTGGAAAGAGTGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922700784 1:227759099-227759121 GTGAACCCTTTGGGAAAGAAGGG + Exonic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065462201 10:25980349-25980371 TTAAGCCTCTTGAGAAAAAGCGG + Intronic
1070553148 10:77507206-77507228 TGGAACACCATGGGAAAATGAGG + Intronic
1070675001 10:78406323-78406345 TTAACCCCCTGGGGTAAAAGGGG + Intergenic
1071416226 10:85444440-85444462 TCTAACACATTGGGAAAAAGAGG + Intergenic
1072320811 10:94247848-94247870 TAGCATCCCTTGGGGAAAAGAGG + Intronic
1074055696 10:109921729-109921751 TTGAACCCCTTGGGCTGAAATGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081739759 11:45430583-45430605 GTGAGCCCCTTGGCAGAAAGAGG + Intergenic
1081744498 11:45463369-45463391 TTGAACCTCATGGGGCAAAGGGG + Intergenic
1081800913 11:45858768-45858790 CTGAACCCTTTGGGAAAGAACGG + Exonic
1082124571 11:48416605-48416627 ATAAGCCCCTTGGGAGAAAGAGG - Intergenic
1082251484 11:49986136-49986158 ATAAACCCGTTGGGAGAAAGAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083516934 11:63268629-63268651 TTTTACCCCTTGGAAAACAGAGG + Intronic
1084589120 11:70079855-70079877 TTGCACCCCTTGGGTCACAGTGG + Intronic
1085272091 11:75276413-75276435 TCCAACTCATTGGGAAAAAGGGG - Intronic
1086872144 11:92050660-92050682 AGGAAGCCCTTGGGAATAAGAGG + Intergenic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1089020174 11:115205569-115205591 TGGAATCCTTTGTGAAAAAGTGG - Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1094178855 12:27569637-27569659 TTGAACCCCCTGGGAGGCAGAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095079946 12:37987674-37987696 TTGAACCCATTGAGGAAAAAGGG + Intergenic
1095080953 12:37998828-37998850 TTGAGGCCCTTGGGAAACAAAGG + Intergenic
1096740152 12:53687367-53687389 TGGAACCACGTGGGAGAAAGAGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097415731 12:59313899-59313921 TTGAAAACCTAGGGAAAAAAAGG + Intergenic
1099741900 12:86648476-86648498 TTAATACCCTTGTGAAAAAGAGG + Intronic
1103480476 12:121247178-121247200 TTGGACCCACTGGGAAGAAGTGG - Intronic
1103971695 12:124676523-124676545 TTGAAGACCTTGGGAAATAGCGG - Intergenic
1104119706 12:125787628-125787650 TTGAACCACCTGGGACCAAGTGG - Intergenic
1106472962 13:30074236-30074258 ATGAACACATGGGGAAAAAGTGG - Intergenic
1108876586 13:55056761-55056783 TTGAACCATTTGGGTAAAAGGGG - Intergenic
1110622914 13:77619157-77619179 TTGAACCCATTAGGAGAAAGAGG + Intronic
1112851112 13:103707660-103707682 TTGAATCACTTGGGAAAAAATGG - Intergenic
1115662011 14:35505589-35505611 TTTAAGCACTTGGGATAAAGTGG + Intergenic
1118058227 14:62105629-62105651 TTGAATCACTTGAGAACAAGTGG - Exonic
1122942424 14:104987488-104987510 ATGAACCATTTGGGAAGAAGTGG - Intronic
1125093197 15:35819635-35819657 TTCTACCCCTTGGGGGAAAGAGG - Intergenic
1129130153 15:73486491-73486513 TTGAGCCCAATGGGTAAAAGAGG - Intronic
1134897226 16:17899164-17899186 TTGTTACCATTGGGAAAAAGTGG - Intergenic
1135562289 16:23486147-23486169 TTGTTCCTTTTGGGAAAAAGAGG + Exonic
1136242803 16:28954820-28954842 ATGAATCGCTTGGGGAAAAGAGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138949050 16:61888301-61888323 TAGAACCCATGGGGACAAAGTGG - Intronic
1140245905 16:73249246-73249268 TTGAAGCCATTTGCAAAAAGAGG + Intergenic
1141992775 16:87620072-87620094 GTAAACCCCTTGGGAAACAGAGG + Intronic
1142297870 16:89238572-89238594 ATGAAGCCTTTGGGAAAATGTGG + Intergenic
1143718504 17:8793648-8793670 TTTTTCCCCTTTGGAAAAAGGGG + Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145901496 17:28493331-28493353 TAGAACCCCTGGAGGAAAAGGGG + Intronic
1152512163 17:80797835-80797857 GGGACCCCCGTGGGAAAAAGGGG - Intronic
1153336820 18:3933410-3933432 TTGAACCCCTTAGCAGAAATGGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155895109 18:31315528-31315550 TTCAATGCCTTGTGAAAAAGAGG + Intergenic
1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG + Intergenic
1158665750 18:59431144-59431166 TTGATCCCCTGGGGAGTAAGAGG + Exonic
1161044883 19:2129450-2129472 CTGAACCCCTGGGGAACAAGGGG + Exonic
1163803607 19:19383217-19383239 ATGTGTCCCTTGGGAAAAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166523458 19:43496370-43496392 GTGAGACCCTTGGGAAAAAATGG - Intronic
1166559601 19:43723356-43723378 TTGAACCCAGTGGGCATAAGTGG + Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925047610 2:785966-785988 TGGATCCCTGTGGGAAAAAGCGG + Intergenic
926864372 2:17341936-17341958 TTGGACCATTTGGGTAAAAGGGG - Intergenic
927620094 2:24646311-24646333 ATGAACCATTTGAGAAAAAGTGG + Intronic
931081306 2:58774902-58774924 TTGAAACCATTGGGAGTAAGTGG + Intergenic
932526467 2:72475341-72475363 GTGAACCACTTGGGACTAAGAGG - Intronic
935675179 2:105589180-105589202 TTCAACCCCTGGGGCACAAGGGG - Intergenic
937743981 2:125389083-125389105 TTGAACACATTGGGAAAACTTGG - Intergenic
940891965 2:159044018-159044040 TTGAAACCCAGGGGAAGAAGAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943179530 2:184525025-184525047 TTGAGCCTGTGGGGAAAAAGGGG + Intergenic
943799146 2:192035868-192035890 TGGAACCACTTTGGAAATAGGGG - Intronic
944899353 2:204198509-204198531 TGGCATCCCTTGGGGAAAAGGGG - Intergenic
948062858 2:235054338-235054360 GTGAATCACGTGGGAAAAAGTGG + Exonic
948702050 2:239766638-239766660 TTGAGCCCCTGGGGAAAGACTGG - Intronic
1169795618 20:9459617-9459639 TTGACCTGTTTGGGAAAAAGGGG - Exonic
1170221069 20:13942028-13942050 ATAAAGCTCTTGGGAAAAAGAGG + Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1173820917 20:46019934-46019956 TGGTACCCCTTGGGGAGAAGAGG - Intergenic
1174609786 20:51789744-51789766 TTGAGCCCCTTGGGACATAGGGG - Intronic
1176198580 20:63849180-63849202 TTTAACTCCTAGGGAAACAGAGG - Intergenic
1177068630 21:16472529-16472551 TTCAACCCCAAGGGAAAAACAGG + Intergenic
1177263598 21:18757489-18757511 TTGGACCACTTGGGTAACAGGGG + Intergenic
1178169815 21:30027572-30027594 ATGCACCCCTTCGGCAAAAGTGG - Intergenic
1178979572 21:37251500-37251522 TTGCACCATTTGTGAAAAAGAGG + Intronic
1180235358 21:46456119-46456141 TTTAACACCTTGGCAAAGAGTGG - Intergenic
1182927069 22:34134935-34134957 TTGAGCTCCATGGGAAAGAGTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950188428 3:10959802-10959824 TTGCACCCCTTGAGAAATGGGGG + Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950919114 3:16676339-16676361 TAAAACCCCTTTGGAAAAACTGG + Intergenic
951867710 3:27325936-27325958 TTTGTCCCCTTGGCAAAAAGGGG - Intronic
954881242 3:53837390-53837412 TGGATCCTCTTGGTAAAAAGGGG + Intronic
955486575 3:59440063-59440085 TTGAGCCCCTTGGGAAGAACAGG + Intergenic
955951156 3:64243431-64243453 TTGCCCCCCTTGGGAACCAGTGG + Intronic
958913585 3:100023043-100023065 TTTAACCATTTAGGAAAAAGAGG + Intronic
960878241 3:122318064-122318086 TTGTAACCTTTGGCAAAAAGAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962642840 3:137406418-137406440 TTGAACACCTAGAGAGAAAGAGG - Intergenic
964953342 3:162324041-162324063 TTGGACCATTTGGGTAAAAGGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967531484 3:190553529-190553551 TTGAACCCCTTGGCCAAGGGAGG + Intronic
968013335 3:195302541-195302563 TTGAACGCCTTGGAAAAGTGTGG - Intronic
969226101 4:5799425-5799447 TTCTTCCCGTTGGGAAAAAGAGG + Intronic
971269836 4:25131986-25132008 TTTAACCCCTTTTAAAAAAGAGG - Intronic
971465843 4:26959763-26959785 GTGAAAGCCTAGGGAAAAAGAGG - Intronic
972312925 4:37898293-37898315 TAAAACACCTTGGAAAAAAGAGG + Intronic
972788815 4:42351228-42351250 TTGAATTGCCTGGGAAAAAGAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
977830700 4:101588794-101588816 TTGAATGCCTTGGGAAAGAAAGG + Intronic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
980742330 4:136968416-136968438 TTGAAGTCTTTGGAAAAAAGTGG - Intergenic
980846934 4:138335003-138335025 TTGAACCACATTGGAAAAGGAGG + Intergenic
981540955 4:145845851-145845873 TTGAACCCAGTGGGAGAAAGAGG + Intronic
981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983088199 4:163473160-163473182 GTGAACCGCTTGGGACAAAGTGG - Exonic
983479054 4:168251033-168251055 TTGAAAGCCTTGGCAGAAAGGGG - Exonic
988709630 5:33760757-33760779 TTGAAGCCCTGAGCAAAAAGAGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
991307673 5:65197144-65197166 TTGGACACCTTGAGAAAAGGAGG + Exonic
993318560 5:86442953-86442975 TTGAATCTCTGGGGCAAAAGTGG - Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
994737179 5:103569578-103569600 TTGATCCCCTTGGGGAAAGCTGG - Intergenic
995436222 5:112138984-112139006 TTATACCCCTTGGGCAACAGTGG - Intergenic
995876803 5:116798837-116798859 TTAAACAACTTTGGAAAAAGAGG - Intergenic
997457744 5:134029955-134029977 TGTAACCCCTTGGGAAAACTGGG + Intergenic
998692733 5:144605199-144605221 TTAAATACCTTGGGAATAAGGGG - Intergenic
1001531540 5:172465738-172465760 TTAAATCCCTGGGGTAAAAGAGG + Intergenic
1002681437 5:180968440-180968462 TTGAACCAGTTGGGATAATGTGG - Intergenic
1003623548 6:7723514-7723536 TTGTATCCATTGGGACAAAGGGG - Intergenic
1004765243 6:18719610-18719632 TTGAAGTCATTGGGAATAAGAGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011740200 6:90351989-90352011 TTCAACCATATGGGAAAAAGTGG - Intergenic
1013774068 6:113659429-113659451 GTGAACCCATGGGGAAGAAGAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015854977 6:137614338-137614360 TTGAACCCATTAGGTAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016903910 6:149130544-149130566 TTTATCCACTTGGAAAAAAGGGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017415086 6:154211595-154211617 TTGAAACCAGTGGGAAAAAAAGG + Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024154322 7:46604801-46604823 ATAAAGCCCTTGGGAACAAGGGG + Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025916610 7:65871649-65871671 TTGCACCTCTTGGTAAGAAGCGG - Intergenic
1027666925 7:81051084-81051106 TAGAACCCCTGGGAAAGAAGCGG + Intergenic
1028217602 7:88153672-88153694 TTGAGACCTTTGGCAAAAAGGGG - Intronic
1029642336 7:101828990-101829012 TCGAGCCCCTGGGGAAAAGGAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1035488402 7:159250059-159250081 TTGAATCTCTTGGGGAAAATGGG - Intergenic
1037661962 8:20935491-20935513 TTGAACTCCTGGGGAGAATGTGG - Intergenic
1039787715 8:40848450-40848472 CTGAACCTCTTGGAGAAAAGTGG + Intronic
1040699510 8:50044111-50044133 TTTAACCCCTGGCGAAAAAGAGG - Intronic
1042395397 8:68286023-68286045 TTGAGTCCCTTGGAACAAAGAGG + Intergenic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1044915469 8:97108857-97108879 TTGAAGTCCTTGAGAAAATGTGG - Intronic
1045099910 8:98833761-98833783 TGGAATCCCTTGGCCAAAAGCGG + Intronic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048171528 8:132111246-132111268 TAAATCCCCTTGGGAAAAAATGG + Intergenic
1048209659 8:132444149-132444171 TCACACCCCTTGGGAAATAGGGG - Intronic
1048495160 8:134929091-134929113 TTGTAATCCTTGGGAAAATGTGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1051420124 9:16880858-16880880 TTGAAGCCCCTCTGAAAAAGAGG + Intergenic
1052185666 9:25590971-25590993 TTGGGCCACTTTGGAAAAAGAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055288078 9:74752526-74752548 TTCAACCTCTTGAGAAAAAAAGG - Intronic
1055740512 9:79383121-79383143 TTGAACCTCCTGGGAATAAAGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056106568 9:83352989-83353011 TTGAACCCCTTGGCAGAGAAGGG + Intronic
1056298670 9:85219829-85219851 TTGAAACCCTTTGGAATAAAAGG + Intergenic
1056374705 9:85996420-85996442 TTGAACCCCTTGTGAACCAGAGG + Exonic
1057329292 9:94097834-94097856 TTGACCCTCTTTGGAAAAGGCGG + Exonic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058571245 9:106347269-106347291 TTGAAACCTTTGTGAAAAATTGG - Intergenic
1190540807 X:51476098-51476120 TAAAGCCCCTTGGGAAAAACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192274906 X:69618529-69618551 TTGATTCCCTTGGGAAACATAGG + Intronic
1192284580 X:69721398-69721420 TTGAATCCATAGGGATAAAGAGG + Intronic
1192444624 X:71201541-71201563 TTGGAGCCATTTGGAAAAAGAGG + Intergenic
1192623846 X:72707501-72707523 ATGAACTCCCTGAGAAAAAGGGG + Intronic
1193117188 X:77786365-77786387 TTGGACCCCCTGCGAAAAGGTGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG + Intergenic
1195507349 X:105673096-105673118 TTGTACCTCGTGGGAAAAATAGG + Intronic
1197697433 X:129565644-129565666 TTAAACCCCTTGTGAGATAGTGG + Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198736206 X:139787813-139787835 TTGAACCTCATGGGTAAAACTGG + Intronic