ID: 1048162162

View in Genome Browser
Species Human (GRCh38)
Location 8:132031566-132031588
Sequence ACTGCCCAGCTACCCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048162162_1048162167 27 Left 1048162162 8:132031566-132031588 CCCTCTTGGGGTAGCTGGGCAGT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1048162167 8:132031616-132031638 GGCCCCCAGATCAAAAGATGTGG No data
1048162162_1048162165 -1 Left 1048162162 8:132031566-132031588 CCCTCTTGGGGTAGCTGGGCAGT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1048162165 8:132031588-132031610 TATTTGTCAAAGTACTGAAAGGG No data
1048162162_1048162164 -2 Left 1048162162 8:132031566-132031588 CCCTCTTGGGGTAGCTGGGCAGT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1048162164 8:132031587-132031609 GTATTTGTCAAAGTACTGAAAGG No data
1048162162_1048162166 6 Left 1048162162 8:132031566-132031588 CCCTCTTGGGGTAGCTGGGCAGT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1048162166 8:132031595-132031617 CAAAGTACTGAAAGGGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048162162 Original CRISPR ACTGCCCAGCTACCCCAAGA GGG (reversed) Intronic
901813135 1:11778967-11778989 GCTGCCCAGCTGCCCACAGAAGG - Exonic
904598591 1:31661790-31661812 CCTCCCCAGCTATCCTAAGATGG + Intronic
905170591 1:36107584-36107606 ACTCCCCAGCTCCACCCAGATGG - Intronic
905424726 1:37874205-37874227 CCTGCCCAGCCACCCCAACTGGG + Intronic
905607233 1:39312937-39312959 CATCCCTAGCTACCCCAAGAAGG + Intronic
906714351 1:47955832-47955854 ACTGCTCAGCAACCCCAGGAGGG + Intronic
907951529 1:59188411-59188433 ACAGCCCAGCTCACTCAAGATGG - Intergenic
909806243 1:79876382-79876404 ACTGCACAGCTGGCCCAAGCTGG - Intergenic
911355446 1:96812780-96812802 ACTGTACAGCTACCTCGAGAGGG + Exonic
1068630091 10:59289408-59289430 CCTGCAGAGCCACCCCAAGAAGG + Intronic
1068945233 10:62723117-62723139 GCTGCCCAGCAAACCCCAGATGG - Intergenic
1069843357 10:71353969-71353991 ACTCCCCAGCTGCCCCAAGGAGG - Intronic
1069892914 10:71663052-71663074 CCTGCCCAGATAACCCAGGATGG + Intronic
1069986994 10:72291245-72291267 ACTCCCCAGCTGCCCACAGATGG - Intergenic
1070803696 10:79257986-79258008 TCTTCACAGCAACCCCAAGAAGG + Intronic
1076841816 10:133049637-133049659 ACGGCCCAGCTCCTCCAACACGG + Intergenic
1079173979 11:18121381-18121403 ACTGCCCAGCTGCCCCTACTGGG + Intronic
1080641200 11:34159464-34159486 CCTGACCGGCTACCACAAGACGG + Intronic
1081756665 11:45549613-45549635 ACTGCCCAACCACCCCAAAGAGG + Intergenic
1083294636 11:61708712-61708734 TCCTCCCAGCCACCCCAAGAGGG + Intronic
1084600226 11:70141140-70141162 ACATTCCTGCTACCCCAAGAGGG - Intronic
1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG + Intergenic
1089215677 11:116833188-116833210 ACTGCCCAGCTACCAGAAGGTGG - Intergenic
1093138312 12:15477976-15477998 ACTGCCCTGCTCCACCAAGCAGG + Intronic
1096084536 12:48856846-48856868 ATTCCCCAGCTCCTCCAAGAAGG - Intergenic
1097913137 12:64992206-64992228 GCTGCCCAGCAACACGAAGATGG + Intergenic
1102035503 12:109768634-109768656 AGTGCCCAGCTTCCCCAGCATGG + Exonic
1103393279 12:120589392-120589414 ACTGACCAGCTAGCCCCAGCTGG - Intergenic
1104660513 12:130608573-130608595 ACTGCCCACCTCCCCCCAGGAGG - Intronic
1105267855 13:18837427-18837449 TCTGCCCAGCTGCCCCAAATGGG - Intergenic
1110469139 13:75838777-75838799 CCTGCCCAACTACACCAACACGG - Intronic
1113785839 13:113001775-113001797 TCTGCCCAGCAAACCCAGGAAGG + Intronic
1113969896 13:114180819-114180841 ACTGACCAGCTACCTCATGCAGG - Intergenic
1118984879 14:70745306-70745328 GCTGCTCAGCTTCCCCAATATGG - Intronic
1122366645 14:101198427-101198449 GCTGCCCAGCTCCTCCATGAGGG + Intergenic
1125608693 15:40956805-40956827 CCTGCCCAGCTGCCCCAAGGAGG + Intergenic
1126386384 15:48097650-48097672 AGTGCACACCTACCCCAAGAGGG + Intergenic
1130742282 15:86613619-86613641 ACTTACCAGCTACCTAAAGAAGG + Intronic
1135870454 16:26145098-26145120 AATGCCCAGCAACCCTAACACGG + Intergenic
1135925606 16:26691066-26691088 AATTCCCAGCTGCCCAAAGATGG + Intergenic
1137923465 16:52515496-52515518 ACCGCCCAGCTTCCCAAAGCTGG - Intronic
1139655563 16:68385127-68385149 ACTGCACAACTACCCCAAATGGG + Intronic
1140781590 16:78301843-78301865 CCTGCCCTCCAACCCCAAGAAGG - Intronic
1142187463 16:88701333-88701355 CCTGCCCTTCGACCCCAAGAAGG - Exonic
1144780580 17:17806475-17806497 GATGCCCAGCTTCCCCATGAAGG + Intronic
1145250992 17:21297037-21297059 TCTGCCCACCTGCCCCAGGATGG + Intronic
1145263540 17:21368622-21368644 CCTGCCCAGCATCCCCAAGAAGG - Intergenic
1145863749 17:28227424-28227446 GCGGCTCAGCTACCCCAGGAAGG - Intergenic
1145990722 17:29077855-29077877 ACTGCGCCTCTACCCCCAGATGG - Exonic
1147769172 17:42856035-42856057 ATTGCCTATCTACCCCCAGAGGG - Intronic
1151477259 17:74351109-74351131 TCTTCCCAGCAACCCCATGAGGG - Intronic
1152388602 17:79989914-79989936 ACACCCCAGCCACCCCAGGAGGG - Intronic
1154483552 18:14857658-14857680 TCTGCCCAGCCACCCCATGTGGG - Intergenic
1154483973 18:14859278-14859300 TCTGCCCAGCCACCCCATGTGGG - Intergenic
1157216179 18:45785611-45785633 ACAGCCCAGCAAACCCAGGAGGG + Intergenic
1159689619 18:71469852-71469874 ACTGGCCAGCTACCAGAAGAGGG + Intergenic
1159994543 18:74951073-74951095 GCTGCCCTGCTACCACATGAAGG - Intronic
1164260959 19:23568321-23568343 TCTGCCCAGCTGCCCCATCAGGG + Intronic
1164667606 19:30051867-30051889 ACTGCCTAGCGACTCAAAGATGG - Intergenic
1165792528 19:38500597-38500619 ACTCCCCAGCTAATCCAAGCCGG + Exonic
1168459982 19:56546505-56546527 AATGCCTAGCTTCTCCAAGATGG + Intronic
1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG + Intronic
927324281 2:21785165-21785187 ACCACCTAGCTAGCCCAAGAGGG + Intergenic
931701503 2:64912995-64913017 AGTCCCTAGCCACCCCAAGAAGG - Intergenic
933811926 2:86038001-86038023 ACTCACCAGCTAACCCTAGACGG - Intronic
938493331 2:131777131-131777153 AGTGCCCAGCTCCCCCAGGAGGG + Intergenic
942853604 2:180520262-180520284 ACAGCCTAGCTACCCTGAGAGGG - Intergenic
944316783 2:198292871-198292893 ACTGCCCAGCGAATCCAGGAAGG - Intronic
1170629833 20:18057175-18057197 TCTCCCCAGCTAGCCCCAGAAGG + Intronic
1170741602 20:19063416-19063438 TGTGCCCAGCTACCCCAGAATGG - Intergenic
1173330180 20:42069416-42069438 ACTGCCCATCTCCCACAAAAGGG - Intergenic
1173332927 20:42090326-42090348 TCTTCACAGCTACCCCAAGCTGG - Intronic
1175524771 20:59626005-59626027 CCAGCCCTGGTACCCCAAGATGG - Intronic
1175715198 20:61250970-61250992 ACTCCCCACCTAGCCGAAGAAGG - Intergenic
1176853057 21:13936424-13936446 TCTGCCCAGCTGCCCCATGTGGG - Intergenic
1176976333 21:15326491-15326513 ACTGGCCAGGTCCCCCAAGCAGG - Intergenic
1178247937 21:30972238-30972260 GGTTCCCAGCTCCCCCAAGATGG + Intergenic
1178290030 21:31359135-31359157 ACTGCCCACCCACCCAAAGCAGG + Intronic
1178365835 21:31988072-31988094 ACTGCACGGTTACCCCAAGAGGG - Intronic
1178778965 21:35580991-35581013 AGAGCCCAGCTATCCCAAAATGG - Intronic
1179973510 21:44849465-44849487 ACTGCCCAGGCATCCCACGATGG + Intergenic
1183507934 22:38219839-38219861 ACTGCTCCGCCCCCCCAAGATGG + Exonic
952234156 3:31461958-31461980 CCTGCTCATCTACCCCAATAAGG + Intergenic
953331082 3:42053465-42053487 TATCCCCAGCTCCCCCAAGAAGG - Intronic
961109678 3:124273217-124273239 ACTCCCCAGCACCTCCAAGATGG - Intronic
961558174 3:127710868-127710890 CCTGGCCAGCTCCCCCAAGGTGG - Intronic
961714635 3:128849987-128850009 GCTCCCCAGCTACCCCGTGAGGG + Intergenic
962889435 3:139658202-139658224 ACTGCCCAGCTAACCCACCCTGG + Intronic
969546677 4:7834659-7834681 ACTGCCTTGCTACCCCAAGGGGG + Intronic
969728481 4:8939605-8939627 ACTGCCCAGCTTCCTCGCGAGGG + Intergenic
970817849 4:20179099-20179121 CCTGCCCAGCCACCCCACCATGG - Intergenic
977260303 4:94789036-94789058 AGTGCCCAGGTACCCCTGGATGG + Intronic
980342540 4:131568968-131568990 ACTGTCCATCTTCCACAAGATGG - Intergenic
985627958 5:999835-999857 ACTCCACAGCTCACCCAAGATGG + Intergenic
987238202 5:15964997-15965019 AGTGCCCAGCAACCTCAGGAAGG + Intergenic
990869151 5:60412403-60412425 ACTGCCCAAATACCTCCAGATGG - Intronic
991173502 5:63657260-63657282 ATTGCCCAGATTCCCTAAGAAGG - Intergenic
997523468 5:134538026-134538048 ACTGCCCAGCAGCACCAAGTCGG + Exonic
997764319 5:136484653-136484675 AATGCCCAGGTGTCCCAAGAAGG - Intergenic
997877007 5:137558582-137558604 ACTCCCCACCTTCCCCAAAAAGG - Intronic
997977621 5:138449562-138449584 GCTGCCCAGCGATCCCAAGGAGG - Intergenic
999126903 5:149252598-149252620 ACTGCTGGGCAACCCCAAGAAGG + Intronic
1002495615 5:179609435-179609457 CCTGCCCTCCTACCCCAAGCCGG + Exonic
1002978850 6:2113653-2113675 ACTATCCATCTACCCCCAGACGG + Intronic
1012592939 6:101005300-101005322 ACTGCTCAGCTGCCCCAGGTAGG - Intergenic
1012849967 6:104434809-104434831 ACTGCCCAGCTACAGGCAGAGGG + Intergenic
1017698982 6:157049319-157049341 ACTGCCCAGCTACCAAAGGAAGG - Intronic
1019156730 6:170044254-170044276 ACTGGCCAGTTACCCAAAGGAGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020198323 7:6059371-6059393 AGTTCCCAGCTACCCCAGAAGGG + Intergenic
1022972636 7:35531547-35531569 ACTGGCCAGAAACCCTAAGAAGG - Intergenic
1023637235 7:42224790-42224812 ACTGGCCAGCTAGCCCCAGGGGG - Intronic
1026635477 7:72078253-72078275 ACTCTGCAGCTACCCCGAGAAGG + Intronic
1028535600 7:91887522-91887544 TCTGCCCAGCTGCCCCAAATGGG + Intergenic
1028717505 7:93988704-93988726 ACTGCCCATCTGCCCTTAGAAGG + Intronic
1030645634 7:112058313-112058335 ATTGCCCCTCTACTCCAAGATGG + Intronic
1032101274 7:128980253-128980275 ACAGCCCATCTACCCAAAGTTGG - Intronic
1035423629 7:158751141-158751163 ACTGCCAACCTCCCCCAAAAAGG - Intronic
1045054232 8:98355579-98355601 ACTGGGCAGACACCCCAAGAGGG + Intergenic
1045253319 8:100499262-100499284 ACTGCCTTGCTACCCAAAGTGGG - Intergenic
1046921590 8:119735141-119735163 AGTGTTCATCTACCCCAAGATGG + Intronic
1048162162 8:132031566-132031588 ACTGCCCAGCTACCCCAAGAGGG - Intronic
1048253218 8:132884396-132884418 TCTACCCAGCTTCCCCAAGTTGG - Intronic
1049613714 8:143567433-143567455 ACTGCAGAGCGACCCCAAGCCGG - Exonic
1050538214 9:6648160-6648182 GCTTCCCAGCTACCTCAAGATGG - Intergenic
1051368162 9:16335861-16335883 ACTGCCCAGGTATCCCAGTACGG - Intergenic
1052857602 9:33416803-33416825 ACAGCTCATCTTCCCCAAGAAGG - Intergenic
1058625853 9:106932110-106932132 CCTCTCCAGCTACCCCTAGAGGG - Intronic
1058960778 9:109990959-109990981 ACTTCCCTACTAGCCCAAGATGG - Intronic
1061093926 9:128443462-128443484 CCTGCCCAGCTGCCCCAAAGAGG - Intergenic
1061806689 9:133140933-133140955 TCTGCCCAGCCACCCCCAGCTGG - Intronic
1061941316 9:133885709-133885731 GATGCTCAGCTGCCCCAAGATGG + Intronic
1192658848 X:73021654-73021676 TCTGCCCAGCTGCCCCAACTGGG - Intergenic
1195574846 X:106438243-106438265 ACTGCCCTGCTAGCCCACCATGG + Intergenic
1197348226 X:125350327-125350349 ACAGCCCAGCTGCAGCAAGATGG + Intergenic