ID: 1048163510

View in Genome Browser
Species Human (GRCh38)
Location 8:132041684-132041706
Sequence TGGGGGCCCAGGCAATCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048163505_1048163510 -6 Left 1048163505 8:132041667-132041689 CCTGCAGCCAGGTGAAGTGGGGG 0: 1
1: 0
2: 4
3: 21
4: 308
Right 1048163510 8:132041684-132041706 TGGGGGCCCAGGCAATCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048163510 Original CRISPR TGGGGGCCCAGGCAATCTGT GGG Exonic
900089640 1:914295-914317 GTGGGGCCCGGGCAATCTGCTGG - Intergenic
900151322 1:1180433-1180455 TGGGGGCCGAGGCAAGGGGTTGG - Intronic
901875558 1:12165271-12165293 TGGGGGTGCAGACAGTCTGTTGG + Intergenic
904616377 1:31752413-31752435 TGGGGGCCCAGGCAGTGAGGAGG - Intronic
905202049 1:36322203-36322225 TGGGGGCCGAGGCAGTCCGAAGG + Exonic
912696113 1:111843399-111843421 TTGGGGCCCATGCCATCTGGAGG - Intronic
912968458 1:114258061-114258083 TGGAGACCCAGGAAAACTGTTGG + Intergenic
914880532 1:151543031-151543053 TGAGGGCCCTGGGACTCTGTTGG + Intronic
916274187 1:162976332-162976354 TGGAAGCCCAGGGAAGCTGTTGG + Intergenic
918406553 1:184216653-184216675 TGGGGGCCCAGGAAAGCTGGTGG + Intergenic
919731607 1:200916535-200916557 TGGGGGCCGCGGGGATCTGTGGG + Intergenic
922743918 1:228032356-228032378 TGGGCCCCCAGCCAATCTGCTGG - Intronic
922973296 1:229761174-229761196 TGGGGATCCAGGCAACCTCTTGG + Intergenic
924478068 1:244398903-244398925 TGGAGGCCCAGGAAAGCTGCTGG + Intergenic
1064000323 10:11658428-11658450 TGGGGGCCCAGCTACTCTGGAGG + Intergenic
1066059154 10:31707059-31707081 TGGGGGCCCAGGCTTCCTGGGGG - Intergenic
1070331202 10:75418525-75418547 TGGGTGCTCAGGCAGGCTGTTGG + Intergenic
1072372450 10:94778147-94778169 CTGGAGCCCATGCAATCTGTAGG + Intronic
1073085271 10:100884164-100884186 TGGAGGCCCAGGTACTCTGGGGG - Intergenic
1075824951 10:125347957-125347979 TGGAGGCCCAGGAAAGCTGGTGG + Intergenic
1076409292 10:130234546-130234568 AGGGGGCCCAGGCAGGCTCTGGG - Intergenic
1076652132 10:131997112-131997134 TGGGAGCCCAAGCAGTGTGTAGG + Intergenic
1076846481 10:133071817-133071839 TGGGGGCCTCGGGAAGCTGTGGG + Intronic
1076899789 10:133332855-133332877 TGGTGGCCCAAGCAATCCTTGGG - Intronic
1077159948 11:1108096-1108118 TGGGGGTCCTGGCAGGCTGTTGG + Intergenic
1077699619 11:4429531-4429553 GTGGGGCTCAAGCAATCTGTTGG + Intergenic
1078196766 11:9143165-9143187 TAGGGGCCCAGGGACTCTATTGG + Intronic
1078434069 11:11310037-11310059 TGGGGGCCCTGGCCATCAGAAGG - Intronic
1078916343 11:15782228-15782250 TGGGGGCACTGGATATCTGTGGG + Intergenic
1079324399 11:19479104-19479126 TGGTGGCCCAGTCACTGTGTCGG + Intronic
1081631479 11:44692767-44692789 CAGGGGCCCAGTCAATCAGTGGG - Intergenic
1083839301 11:65294631-65294653 TGGGGGCCGAGGAGATCAGTAGG + Exonic
1084439487 11:69164476-69164498 TGGGGGCCCAGGTGACCTGCAGG + Intergenic
1086080273 11:82896735-82896757 TGGATGCCCAGGCATTCTGCTGG - Intronic
1086100330 11:83092690-83092712 TGGAGGCACTGGCAGTCTGTTGG - Intergenic
1089519393 11:119053861-119053883 TGGAGCCGCAGGCAATATGTAGG - Intronic
1090212221 11:124929244-124929266 TAAGGCCTCAGGCAATCTGTAGG - Intronic
1090865537 11:130697655-130697677 AGGGAGCCCAGGCCAGCTGTGGG - Intronic
1091296929 11:134480470-134480492 TGGAGGCCCAGGCCACCTGGAGG - Intergenic
1091626427 12:2124492-2124514 TGATGGCCCATGCAAACTGTTGG + Intronic
1093035539 12:14329090-14329112 AGGGGGCCCAGGGAAGATGTTGG + Intergenic
1094311345 12:29087018-29087040 TAGGGGCCCAGGCTACTTGTGGG - Intergenic
1094843645 12:34352134-34352156 ACGGGGCCCAGGCACTCTGGGGG + Intergenic
1094855215 12:34399849-34399871 TTGGGCCCTAGGCACTCTGTGGG - Intergenic
1096692416 12:53329133-53329155 TGTGGGCCCAGGGAATGAGTGGG + Exonic
1102021629 12:109687339-109687361 AGGGGGCCTAGGAAATCCGTGGG + Intergenic
1102493745 12:113305162-113305184 TGTGGGCCGAGGCCATCTCTAGG + Intronic
1102594042 12:113978753-113978775 TGGGGACCCAGGCAGTGTGCTGG + Intergenic
1103602619 12:122063844-122063866 TGTGGCCCCAGGCAATGTGAAGG + Intergenic
1105577502 13:21667826-21667848 TGGGGGTCCAGGGAAACTGAAGG + Intergenic
1107339228 13:39388390-39388412 TGGGGTCCTAGGCAATCATTGGG + Intronic
1107833825 13:44397812-44397834 AGGAGGCGCAGGGAATCTGTGGG + Intergenic
1109273890 13:60283232-60283254 TGGAGGTCCAGGAAATCTTTTGG + Intergenic
1109459953 13:62643602-62643624 TGGAGACCCAGGAAATCTGGTGG - Intergenic
1113880710 13:113623952-113623974 TGGGGCCCCAGGCACTTGGTGGG + Intronic
1113982868 13:114290567-114290589 TGGGTGCCCAGGCAAGCTAGAGG - Intronic
1119777410 14:77257673-77257695 TGGGGGCCCAGGCACTCAGTTGG - Exonic
1121017235 14:90556215-90556237 TGGGGTCCCCAGCAATATGTGGG + Intronic
1121255405 14:92526933-92526955 TGGTGGCCCAGGCAATGCCTGGG + Intronic
1202844138 14_GL000009v2_random:151296-151318 TGGGAGCCCACGCTATTTGTTGG + Intergenic
1202913528 14_GL000194v1_random:141539-141561 TGGGAGCCCACGCTATTTGTTGG + Intergenic
1202879131 14_KI270722v1_random:41153-41175 TGGGAGCCCACGCTATTTGTTGG - Intergenic
1124625527 15:31305493-31305515 TGGGGACCCAGGCAGCCTGCTGG - Intergenic
1126558812 15:50020757-50020779 TGAGGGCAGAGGCAATATGTTGG - Intronic
1126645388 15:50870221-50870243 TGGAGGCTCAGCCAATCTCTAGG - Intergenic
1128325972 15:66724584-66724606 TTGGAACCCAGGCAGTCTGTTGG + Intronic
1129374212 15:75117346-75117368 TGGGAGCCCAGGCTATTTATTGG + Intronic
1132013838 15:98299004-98299026 TGGAGGCCCAGGAAAGCTGGTGG - Intergenic
1134507927 16:14823131-14823153 TGGGGGGCCAGGCAACTTTTTGG + Intronic
1136367316 16:29814715-29814737 TGGGGGCCAGGGCCATCAGTTGG - Exonic
1139166298 16:64568468-64568490 TGGAGGGCCAGGAAATCTGATGG - Intergenic
1140979337 16:80091648-80091670 TGGGGGCGCCTGTAATCTGTGGG + Intergenic
1141803128 16:86324309-86324331 TGGGGGCCGAGCCCATCTCTTGG + Intergenic
1144724308 17:17494026-17494048 TGTGGGCCCAGGCAAACTTTCGG - Intergenic
1144854849 17:18262034-18262056 TGGGGCCCCAGCCAGTCTGGGGG - Intronic
1146649572 17:34598387-34598409 TGGGGCCCCAGGTAATCAGGGGG - Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148869289 17:50646672-50646694 TGGGACCCCAGGGAATCTGAAGG + Intronic
1151195995 17:72431417-72431439 TGGGGGCCCAGTGGATGTGTTGG - Intergenic
1151673453 17:75585867-75585889 TGGGAGCCCAGGCTATTTATTGG + Intergenic
1151955732 17:77379282-77379304 TGGGGGCTCAGGCTCTCGGTGGG - Intronic
1152026856 17:77815521-77815543 TGGGGTCCCAGGCCAGCTGCTGG + Intergenic
1152802829 17:82339880-82339902 TGGGGGCACAGGGACTCTGGGGG - Intergenic
1154145194 18:11861219-11861241 GGGGGGCCCAGGCTCTCTGTTGG - Intronic
1155516430 18:26627976-26627998 TGGGGGCCAAGGCAACCTCCCGG - Intronic
1155609588 18:27650096-27650118 TGGATGCCCAGGAAATCTGGTGG - Intergenic
1157126997 18:44965879-44965901 TGGGGTCCCAGGGACACTGTAGG - Intronic
1160823239 19:1067796-1067818 TGGGGGCTTAGGCAATCTGGGGG + Intronic
1161085722 19:2334056-2334078 CGGGGGCCCAGGCACACGGTGGG - Intronic
1161520562 19:4721305-4721327 TCTGGGCTCAGGCAATCTGTTGG - Intronic
1161915567 19:7225591-7225613 TGGGGGACCAAGGAATCTGGAGG - Intronic
1162004177 19:7766649-7766671 TGGCGGCACAGGCGTTCTGTTGG - Exonic
1163338894 19:16691489-16691511 TGTAGGCCCAGGCACTCTGGAGG + Intergenic
1163624367 19:18380435-18380457 TGGGGACCCATGGAAGCTGTCGG + Intronic
1163672521 19:18637174-18637196 TTGGAGCCCAGGAAACCTGTGGG + Intronic
1202654752 1_KI270708v1_random:10161-10183 TGGGAGCCCACGCTATTTGTTGG - Intergenic
925412290 2:3646911-3646933 TGGGGGGCCAGGCTGTGTGTGGG + Intergenic
925669890 2:6300402-6300424 TGTGGTCCCAGGCACTCTGAAGG - Intergenic
926859768 2:17296874-17296896 TGAAGGCCAGGGCAATCTGTTGG - Intergenic
927299529 2:21495835-21495857 TGTGGTCCCAGCCACTCTGTTGG + Intergenic
927426881 2:22990845-22990867 TGGGGTCCCAAGCAATCACTGGG - Intergenic
927427748 2:23000083-23000105 TAGAGGCCCAGGAAATCTGGTGG + Intergenic
929600932 2:43204136-43204158 TGGGGGGACATGCAAACTGTGGG + Intergenic
929602716 2:43214531-43214553 AGGGGGCCCAGAGAGTCTGTGGG - Intergenic
929655768 2:43730175-43730197 TGGGGCCACAGGCCACCTGTGGG - Intronic
929968120 2:46550785-46550807 TGCGGGCCCAGGCTAGCTCTGGG + Intronic
931048002 2:58379006-58379028 TGGAGGCCCAGGAAAGCTGACGG + Intergenic
933896321 2:86813761-86813783 TGAGAGCTCAGGCAATCTTTGGG - Intergenic
935622015 2:105138387-105138409 TGGAGGCCCAGGAAAGCTGGTGG + Intergenic
937910538 2:127073546-127073568 TGGGTGCTCAGGCCACCTGTGGG - Intronic
938081580 2:128373128-128373150 TGGGGGCCCAGGAAGGCTCTAGG + Intergenic
938103490 2:128513930-128513952 GGGGGACCCAGGCAATAAGTAGG - Intergenic
942022861 2:171884167-171884189 AGTGTGCCCAGCCAATCTGTGGG + Intronic
945837670 2:214852133-214852155 TGGAGGCCCAGGAAAGCTGGTGG + Intergenic
945968421 2:216212602-216212624 AGGGGGTCCATTCAATCTGTAGG + Intergenic
946161731 2:217839827-217839849 TGGAGCCCCAGGCATGCTGTCGG - Intronic
1169873521 20:10272018-10272040 TGGAGGCTCAGGCACTCTGCTGG + Intronic
1170647954 20:18213451-18213473 TGAAGGCCAAGGAAATCTGTGGG - Intergenic
1172501555 20:35431782-35431804 TGGGAGCCCAGGCCTTCAGTAGG + Intergenic
1172991447 20:39040097-39040119 TGGGAGCCCGGACAATCTGGAGG + Intergenic
1174367053 20:50062840-50062862 TGGGGGGCCTCCCAATCTGTAGG - Intergenic
1175196933 20:57250729-57250751 TGGGGGCACAGGCAACCTGCTGG - Intronic
1175797825 20:61783851-61783873 TGGGGGCACAGGACATCTGAGGG - Intronic
1175797880 20:61784101-61784123 TGGGGGCACAGGACATCTGAGGG - Intronic
1175797950 20:61784413-61784435 TGGGGGCACAGGACATCTGAGGG - Intronic
1175798007 20:61784663-61784685 TGGGGGCACAGGACATCTGAGGG - Intronic
1175884902 20:62284252-62284274 TGGGGTCCCAGGGAACCTTTGGG + Intronic
1176004155 20:62850682-62850704 TGGGGGCCTCGGCAGTCTTTGGG - Intronic
1176640433 21:9298614-9298636 TGGGAGCCCACGCTATTTGTTGG - Intergenic
1180349458 22:11787997-11788019 TGGGAGCCCACGCTATTTGTTGG - Intergenic
1180388749 22:12204237-12204259 TGGGAGCCCACGCTATTTGTTGG + Intergenic
1181500871 22:23314877-23314899 TGGGGGCCCAGGCCACCTCCTGG + Intronic
1181693965 22:24583761-24583783 TGGTGTTCCAGGCAATCTCTGGG - Intronic
1181790740 22:25263996-25264018 TGGAGGCCCAGGAAAGCTGGTGG + Intergenic
1182740526 22:32564049-32564071 TGGGGGGCCACGCAATCCTTAGG + Intronic
1183099772 22:35576735-35576757 TGAGGTCCCAGGCAAGCTGGTGG + Intergenic
1184529137 22:45043359-45043381 TGGGTGCCCAGGGAAGGTGTGGG + Intergenic
1185114480 22:48923814-48923836 TGGAGGCCCAGGAAAACTGGAGG - Intergenic
950667630 3:14506789-14506811 TGGGGGCCCAGGTAATACCTTGG - Exonic
951822737 3:26831030-26831052 TGGTGACCCAGGTAATCTTTAGG - Intergenic
955196470 3:56808983-56809005 TTGGAGCCAAGGGAATCTGTGGG + Intronic
964427117 3:156565557-156565579 TGGAGGCCCAGGAAAACTGCTGG - Intergenic
965665706 3:171091361-171091383 TGGAGACCCAGGGAAGCTGTTGG - Intronic
967079766 3:186038566-186038588 TGGGGGCCAAGGGAAGCTGCCGG + Intergenic
1202746460 3_GL000221v1_random:106410-106432 TGGGAGCCCACGCTATTTGTTGG + Intergenic
969817573 4:9697853-9697875 CGGAGGCCCATGCAAGCTGTTGG + Intergenic
971322119 4:25614118-25614140 TGGGGGCTCTGGCAATCAGTGGG + Intergenic
973975269 4:56256801-56256823 TAGGGGTCCATTCAATCTGTTGG - Intronic
976830984 4:89313474-89313496 TGGAGGCCCAGGAAAGCTGGTGG + Intergenic
977571184 4:98631512-98631534 TGGAGGCCCAGGCAGTCTGGAGG - Intronic
985650171 5:1103947-1103969 TCGGGGCCCAGGCAGCCTGCAGG + Intronic
985672409 5:1213404-1213426 TGGGGGGCCAGGCATGCGGTGGG - Intronic
988926586 5:35996575-35996597 TGGGGCCCCTGTCAATCTTTTGG + Intergenic
991498665 5:67253459-67253481 TGTGGGCCAAGGCACTCTGCTGG - Intergenic
993574025 5:89579311-89579333 TGGGTGCTCAGGCAATCATTAGG - Intergenic
995833432 5:116377879-116377901 TGAGGGACCAGGCGATCTGCAGG - Intronic
996603968 5:125298789-125298811 AGACAGCCCAGGCAATCTGTTGG + Intergenic
997195854 5:131979169-131979191 TGTGGGCCCAGGTACTCTGTGGG - Intronic
997195859 5:131979186-131979208 TGTGGGCCCAGGTACTCTGTGGG - Intronic
997358699 5:133280753-133280775 TGGAGGGCCAGGGAAGCTGTAGG - Intronic
997613875 5:135233097-135233119 TGGCAGCCCAAGCAAGCTGTGGG - Intronic
997643874 5:135467440-135467462 TGGGTAGCCAGGCACTCTGTTGG - Intergenic
1000565647 5:162843643-162843665 TGGAGGCCCAGGAAAACTGGTGG - Intergenic
1001603706 5:172945334-172945356 TGGGGGCCCACGCACTCTAAGGG - Intronic
1001855101 5:175003952-175003974 GGGGGGCTGAGGCAATCTGGGGG + Intergenic
1002451223 5:179319904-179319926 TCTGGGACCAGGCATTCTGTGGG - Intronic
1002716929 5:181233835-181233857 TTGGGCCCCAGGGAAACTGTGGG + Intronic
1003150650 6:3546084-3546106 TGGGGACCCAGGAAAGCTGGTGG + Intergenic
1003479643 6:6519275-6519297 TGGGGGACCAGGCATTGGGTAGG - Intergenic
1004180033 6:13372937-13372959 TGGGGGCTCTGCCAATCTGCTGG - Intronic
1005791363 6:29305038-29305060 TGGAGGACCAGGAAAACTGTAGG + Intergenic
1006578313 6:35061812-35061834 AGGGGGCTCAGGCAATGCGTGGG + Intronic
1007472386 6:42099317-42099339 AGGGGGCCCAGGCTCTCTGATGG + Intergenic
1014715223 6:124856898-124856920 TGGAGGCCCAGGAAAGCTGGTGG - Intergenic
1015094170 6:129395081-129395103 TGGGAGCCCATGAAACCTGTTGG - Intronic
1019854163 7:3587406-3587428 TGGAGACCCAGGCAAGCTGGTGG + Intronic
1019987772 7:4670319-4670341 TGTGGGCCCAGGTACTCTGGAGG - Intergenic
1023856651 7:44188317-44188339 TGGGGGCCCAGGCAGAGTGGGGG - Intronic
1027917764 7:84348039-84348061 TGGGGGGCCAGGGAATGTATGGG + Intronic
1029956176 7:104642690-104642712 TGGGGGCCCAGGCTATGGGAAGG - Intronic
1034425328 7:151010892-151010914 AGGGGGCCCAGCCCATCTGGGGG - Exonic
1038027947 8:23608992-23609014 TGGGGGCCCAGGAAAGCAGTTGG - Intergenic
1040869071 8:52081280-52081302 AGGGGGCCCAGGAATTCTGTGGG - Intergenic
1043138481 8:76558111-76558133 GAGGGGCCCAGGGCATCTGTGGG + Intergenic
1043164160 8:76882472-76882494 TGGAGGCCCAGGAAAGCTGGTGG - Intergenic
1046682461 8:117185424-117185446 AGGGCTCCCAGGAAATCTGTGGG - Intergenic
1046889354 8:119404249-119404271 TTTGGGCCCAGGCAGTCTGATGG + Intergenic
1048163510 8:132041684-132041706 TGGGGGCCCAGGCAATCTGTGGG + Exonic
1048843154 8:138582331-138582353 TGAGGCCCCAGGCACTCAGTGGG + Intergenic
1049299632 8:141862726-141862748 GGGGGGCCCAGGCTCTGTGTGGG + Intergenic
1049351557 8:142167383-142167405 TGGGGGACCTGTCAAACTGTTGG + Intergenic
1051135183 9:13912114-13912136 TGGAGGCCCAGGAAAGCTGGTGG + Intergenic
1051867189 9:21695905-21695927 CCGGTGCCCAGGCATTCTGTCGG + Intergenic
1054808116 9:69412420-69412442 GGGGGTCCCAGCCAATCTGATGG - Intergenic
1055993357 9:82131200-82131222 TGGTGGCCCCTGCCATCTGTGGG + Intergenic
1056789908 9:89618561-89618583 TGGGGGCCCAGGCCACCTCCTGG + Intergenic
1057910354 9:99015507-99015529 AGGGGAGCCAGGCCATCTGTGGG - Exonic
1059434948 9:114270582-114270604 TGGGGGCCCTGGCACACAGTGGG - Intronic
1060736974 9:126072153-126072175 TGAGGTCCAAGGCCATCTGTGGG + Intergenic
1062147245 9:134996502-134996524 GAGGGGCCCAGGCAGTCAGTGGG + Intergenic
1062522792 9:136965357-136965379 GGGGGGCTCAGGGAATCTTTAGG + Intergenic
1202800448 9_KI270719v1_random:170440-170462 TGGGTGCCCAGGCGAGCTGGAGG - Intergenic
1203755721 Un_GL000218v1:123839-123861 TGGGAGCCCACGCTATTTGTTGG + Intergenic
1203715097 Un_KI270742v1:136503-136525 TGGGAGCCCACGCTATTTGTTGG + Intergenic
1190776852 X:53559517-53559539 TGAGGGACCAAGCAACCTGTAGG + Exonic
1191682234 X:63853010-63853032 TGGGGGCATAGGGAATCTGAGGG - Intergenic
1194034025 X:88848576-88848598 TGGGAGCCCATGCTATTTGTTGG + Intergenic
1196221464 X:113115800-113115822 TGGGGACACAGGCTTTCTGTGGG + Intergenic
1197025559 X:121744675-121744697 TGGAGGCCCAGGAAAGCTGATGG - Intergenic
1198170384 X:134099485-134099507 TGGAGGCCCAGGAAAGCTGGTGG - Intergenic
1199542050 X:148968169-148968191 TGGGGCCCCAGCCTAACTGTGGG - Intronic
1199999530 X:153051205-153051227 TGGGGGCCCTGGCCTTCTGTTGG + Intergenic
1201169327 Y:11241444-11241466 TGGGAGCCCACGCTATTTGTTGG + Intergenic
1202333950 Y:23785993-23786015 TGGGGGCCCAGTCAGGCTGGTGG - Intergenic
1202536818 Y:25884066-25884088 TGGGGGCCCAGTCAGGCTGGTGG + Intergenic