ID: 1048163924

View in Genome Browser
Species Human (GRCh38)
Location 8:132045346-132045368
Sequence CTCAGGTGGGTCCCTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048163924_1048163929 20 Left 1048163924 8:132045346-132045368 CCACCTTCAGGGACCCACCTGAG 0: 1
1: 0
2: 0
3: 25
4: 235
Right 1048163929 8:132045389-132045411 TGAGAAAATTTTCGCTTCCCCGG No data
1048163924_1048163930 21 Left 1048163924 8:132045346-132045368 CCACCTTCAGGGACCCACCTGAG 0: 1
1: 0
2: 0
3: 25
4: 235
Right 1048163930 8:132045390-132045412 GAGAAAATTTTCGCTTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048163924 Original CRISPR CTCAGGTGGGTCCCTGAAGG TGG (reversed) Intronic
900701896 1:4053689-4053711 ATCAGGTGGGTCCCTGACTGTGG - Intergenic
901192626 1:7421726-7421748 ACCAGGTGGGTCCGTGATGGAGG + Intronic
901194556 1:7433133-7433155 CTCATGGAGGTCCCTGAGGGAGG + Intronic
902805888 1:18861162-18861184 CTCAGACTGGGCCCTGAAGGAGG - Intronic
903177924 1:21591583-21591605 CTCAGGGGTCTCCCTGGAGGTGG - Intergenic
905267587 1:36765308-36765330 TTCAGGTGGCTCCCTGCAGCTGG - Intergenic
906534972 1:46546365-46546387 CTCAGATTGGTCTGTGAAGGAGG + Intronic
906661499 1:47586017-47586039 TTCTGCAGGGTCCCTGAAGGAGG + Intergenic
906685645 1:47761451-47761473 CCCAGCTGGGTCATTGAAGGGGG + Exonic
907337035 1:53706559-53706581 CCCTGGTGGGGCCTTGAAGGTGG - Intronic
909146063 1:71933608-71933630 CTCATGTCGGTTTCTGAAGGTGG + Intronic
910376870 1:86582043-86582065 CTCAGGTGGGTCCCAGTAGTGGG + Intergenic
915356326 1:155257053-155257075 CTAAGGTGGCTTCCTGGAGGAGG - Intronic
915405650 1:155657883-155657905 CTAAGATGGGACCCTAAAGGGGG - Intergenic
915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG + Exonic
915876580 1:159617041-159617063 CTCAAGTGGGTCCCTGACCCAGG + Intergenic
916078505 1:161217645-161217667 CTCAGATGGGTCCCTTGAGGTGG + Intronic
917232737 1:172855729-172855751 CTCAAGTGGGTCCCTGACCCTGG - Intergenic
917648066 1:177048284-177048306 CTCAGGAGAGTCCCTGAATCAGG - Intronic
917677295 1:177331865-177331887 CACAGGTGAGTCCCAGAAAGAGG - Intergenic
917796902 1:178539171-178539193 CTGTTGGGGGTCCCTGAAGGTGG - Intronic
918813291 1:189149639-189149661 CTCACCTAGGTCCCCGAAGGCGG - Intergenic
921261456 1:213388435-213388457 CTCAGGTGGGGGCCTGGTGGGGG + Intergenic
922800414 1:228362405-228362427 CTCAGGAGGCTGCCTGGAGGTGG - Intronic
1063847386 10:10145804-10145826 TGCAAGTGGGTCCCTGCAGGAGG - Intergenic
1066229803 10:33421260-33421282 CTCAAGGGGGTCCCAGCAGGTGG + Intergenic
1067220844 10:44343216-44343238 ATCAGGTGGGTAAATGAAGGGGG + Intergenic
1067539836 10:47143503-47143525 CTCAGGCAGGTCCCTGAAGAGGG + Intergenic
1068960053 10:62858602-62858624 CTGAGGGCGGTCCCTGGAGGAGG - Intronic
1069264230 10:66438169-66438191 CTCAAGTGGGTCCCTGAACCCGG - Intronic
1070974494 10:80595487-80595509 CACAGAGGGGTCCCTGAAGCGGG - Intronic
1073116208 10:101093374-101093396 CTGTGGAGGGGCCCTGAAGGTGG - Intronic
1073179868 10:101577269-101577291 CCCAGATGGGTCACTGGAGGTGG + Intronic
1075492210 10:122880735-122880757 CTGAGGTGTGGCCCTGATGGAGG + Intergenic
1075498669 10:122952946-122952968 CTGAGGTGTGGCCCTGATGGAGG - Exonic
1076062595 10:127425253-127425275 CTCTGGTGGGTCTCTGCAGCTGG + Intronic
1076947030 10:133658487-133658509 CTCTGCAGGATCCCTGAAGGAGG - Intergenic
1077530643 11:3093255-3093277 CACAGGGAGGTCCCTGCAGGCGG - Intronic
1080843676 11:36007426-36007448 CTCAGATGGGTCCCAGAAGCAGG - Intronic
1081802242 11:45868010-45868032 CTCAGGTGTGACCCTAGAGGTGG + Intronic
1082984088 11:59152098-59152120 CTCAGTTGTTTCCCTGAAGGTGG + Exonic
1083401542 11:62426582-62426604 CTCCGGTGGGGCCTTGATGGGGG + Intergenic
1083510280 11:63202825-63202847 CTCAAGTGGGTCCCTGACCCCGG + Intronic
1083718076 11:64590645-64590667 CTGAGGTGGGGCTCTGCAGGAGG + Intronic
1084098318 11:66928080-66928102 CACAGGTGGGCTTCTGAAGGTGG - Intronic
1084680789 11:70665067-70665089 ATCAGAGGGGTCCCTGTAGGAGG - Intronic
1085270130 11:75265298-75265320 CTGAGGAGGGTTCCCGAAGGGGG - Exonic
1085387683 11:76166400-76166422 CGCAGGAGGGTACCTGCAGGAGG + Intergenic
1086573295 11:88308855-88308877 CTCAGGTGGTTACCGGCAGGAGG + Intronic
1086979464 11:93177812-93177834 CTCATGTGGGTCCCTGACCCCGG - Intronic
1089586654 11:119513786-119513808 CCCAGGAGGGCCCCTGAAGTTGG - Intergenic
1090620066 11:128552743-128552765 CTCAGCTGGGTCTCTGATGTCGG + Intronic
1090713195 11:129406640-129406662 CTGAGAAGGGACCCTGAAGGAGG + Intronic
1090868597 11:130723567-130723589 CCCAGATGGATCCCTTAAGGTGG + Intergenic
1091277212 11:134360603-134360625 CGCAGGTGGGTGCCTGGAGGTGG - Intronic
1091966019 12:4742630-4742652 CTAAGGAGGGTTCCTGGAGGAGG + Intronic
1092077778 12:5687521-5687543 GTCAGGTGGGGTCCTGATGGAGG + Intronic
1092836393 12:12493098-12493120 GGCAGGGGGATCCCTGAAGGAGG - Intronic
1096113184 12:49040820-49040842 CCCAGGTGGGTGCCTGAGGAGGG + Exonic
1099030897 12:77524453-77524475 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1099527729 12:83736196-83736218 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1101524826 12:105519303-105519325 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1102764356 12:115419214-115419236 CTCATTTGGGTATCTGAAGGTGG - Intergenic
1105217814 13:18299784-18299806 CTCAGTTGTGTCCTTGCAGGAGG - Intergenic
1109396649 13:61766867-61766889 CTCAGGTGGGAGGCTGCAGGTGG + Intergenic
1111071324 13:83171842-83171864 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1111360405 13:87168282-87168304 GTGAGGTGGGTTCCTGAGGGTGG - Intergenic
1115546698 14:34470612-34470634 CTCAGCTGTGTCCCAGCAGGAGG - Intergenic
1118498513 14:66333407-66333429 CTCAAGTGGGTCCCTGACCCTGG + Intergenic
1121267892 14:92616116-92616138 CTCAGGAGGGTCCTGGTAGGTGG - Intronic
1121338154 14:93089654-93089676 GTCAGCTGGGTCTCTGGAGGAGG + Intronic
1122037861 14:98961491-98961513 CTGAGGAGGGGCCCTGGAGGGGG - Intergenic
1122893781 14:104745217-104745239 CTCCCGTGGCTCCCTGCAGGTGG - Intronic
1123041764 14:105493145-105493167 CTCCTGTGGGGTCCTGAAGGTGG + Intronic
1123217681 14:106827062-106827084 CTCAGGTGGGTCTCAGGATGTGG - Intergenic
1202921092 14_KI270723v1_random:31040-31062 CTCTGCAGGCTCCCTGAAGGAGG - Intergenic
1202923818 14_KI270724v1_random:6538-6560 CTCTGCAGGCTCCCTGAAGGAGG + Intergenic
1129150309 15:73684281-73684303 CTCCGGTGCGTCCCTGAGGCCGG - Exonic
1129239909 15:74245050-74245072 CTCTGGTGGCTGCCTGGAGGAGG - Intronic
1130432393 15:83861340-83861362 CTCAAGTGGGTCCCTGACCCCGG + Intronic
1132360243 15:101206455-101206477 ATCAGCTGGGGCTCTGAAGGCGG + Intronic
1133297790 16:4763561-4763583 CTGAGATGGGTCCCTGACGCTGG - Intronic
1134608211 16:15587501-15587523 CTCAGGTGTGTGCCTGGAGGGGG + Exonic
1136590816 16:31216642-31216664 CCCAGGAGGGACCCTGAAGGAGG + Intronic
1136597532 16:31261780-31261802 CTCACCTGGATCCCTGAAGCTGG - Exonic
1137555696 16:49469023-49469045 CTCAGCTGGGTCCCTGGGGCTGG + Intergenic
1138849214 16:60605878-60605900 CTCACCTAGGTCCCTGCAGGTGG + Intergenic
1139374278 16:66487075-66487097 CTCAGCTGGCTCCCTGCAGCTGG - Intronic
1140453884 16:75093411-75093433 CTCAAATGAGTCCTTGAAGGAGG + Intronic
1140720628 16:77768655-77768677 CTCATGTGGCTCCTTGAAGGAGG + Intergenic
1142852221 17:2709758-2709780 CTCAGGTGGGCCCCAGCTGGGGG + Intronic
1143389096 17:6549583-6549605 CACACGTGGGACCCTGGAGGTGG + Intronic
1143658934 17:8312987-8313009 CTCAGATGGGTGCCTGTGGGGGG + Exonic
1143723286 17:8828549-8828571 CTCAGGTGGGGCCCCGACGTGGG - Exonic
1149721717 17:58851720-58851742 CTCAAGTGGGTCCCTGACCCAGG - Intronic
1151020728 17:70614088-70614110 CTCAGGCAGGTCCTTGTAGGAGG + Intergenic
1152161877 17:78673999-78674021 CTCAGGCGGGGCCCTCGAGGTGG - Intergenic
1152575107 17:81136494-81136516 CTGAGGTGGGGTCCTGGAGGTGG - Intronic
1153616172 18:6936322-6936344 CTGAATTGTGTCCCTGAAGGTGG - Intergenic
1153762876 18:8348560-8348582 CTCAGGTGGGTTCATTAAAGAGG - Intronic
1154374737 18:13799556-13799578 CTCAGGTGAGTGCCTGAAGAGGG - Intergenic
1157114734 18:44852205-44852227 CTCAGAGGAGCCCCTGAAGGTGG - Intronic
1157601084 18:48893655-48893677 GTCAGGTGGAGCCCTGTAGGAGG - Intergenic
1160866423 19:1258238-1258260 CTCAGGTTGGGCCGGGAAGGAGG - Exonic
1161032537 19:2064835-2064857 CTCAGGGGGATCCCTGAGGCCGG + Intergenic
1163150068 19:15406220-15406242 CCCAGCTGGGTCCCTTCAGGAGG + Intronic
1164798320 19:31054564-31054586 CTGAAGTGGGACCCTGCAGGGGG + Intergenic
1166075689 19:40412670-40412692 CTGGGGTGGGTCCCTGGAGTAGG - Intronic
1166113163 19:40635571-40635593 GACAGGTGTGTCCCTGAAGCTGG + Intergenic
1166144269 19:40823601-40823623 CCCAGGCTGGTCTCTGAAGGGGG - Intronic
1166224411 19:41386155-41386177 CTCAGAGGGGACCCTGAAAGAGG - Intronic
1167672082 19:50859226-50859248 CCCAGGTGAGGCCCTGCAGGAGG - Intronic
1167674836 19:50877652-50877674 CCCAGGTGAGGCCCTGCAGGAGG - Intronic
1167834987 19:52061088-52061110 CTAAGTTGGGGCCCTAAAGGGGG + Intronic
1168093713 19:54102532-54102554 CTTAGGTGGGTCGCAGCAGGAGG + Intronic
926147863 2:10407639-10407661 TTGAGGTGGGTCCTTGGAGGAGG + Intronic
926422816 2:12716431-12716453 CTCAGATGTGGCCCTGAATGAGG - Intergenic
927018943 2:18997707-18997729 CTGAAGTGTGTCCCTGAAGGTGG + Intergenic
927938227 2:27087115-27087137 TGCAGGTGGCTCCCTGGAGGAGG + Exonic
929566577 2:42990160-42990182 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
929916741 2:46142754-46142776 CTCAGGTGGGGCAAAGAAGGAGG - Intronic
931977104 2:67654751-67654773 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
932152807 2:69387919-69387941 CTCAGGTGGGTCATGGGAGGAGG - Intergenic
932588120 2:73044907-73044929 CTCAGGTGGGGCCTTGAGGCAGG - Intronic
933791848 2:85889162-85889184 CCCGGGTGCGTCCCTGCAGGGGG - Intergenic
934296490 2:91746881-91746903 CTCAGTTGCGTCCTTGCAGGAGG + Intergenic
934518659 2:95005702-95005724 CTTGGCTGGGTCCCTGGAGGTGG + Intergenic
935350177 2:102145703-102145725 CTCAAGTGGGGCCGTGAATGTGG + Intronic
935476649 2:103530768-103530790 CCCAGGTGGCTCCATGAAGTAGG - Intergenic
937121464 2:119442373-119442395 CTGAGGTGGGTCCCTGAGAAAGG - Intronic
938221220 2:129569501-129569523 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
938797462 2:134730475-134730497 ATCAACTGGGTCCCTGAAGGAGG + Intergenic
938962118 2:136353388-136353410 CTCTTGTTGTTCCCTGAAGGAGG + Intergenic
940377230 2:152969919-152969941 CTAAGATGGGGCCCTAAAGGGGG - Intergenic
941593387 2:167447301-167447323 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
942017153 2:171828924-171828946 CTAAGATGGGGCCCTAAAGGGGG + Intronic
942689976 2:178574876-178574898 CTCAGGTGGGTCCCAAGAGAAGG + Exonic
944635659 2:201673913-201673935 CTCAGGTGGGCCCTGGAAAGGGG - Intronic
948939056 2:241187241-241187263 CTGAGGTGGATCCCTGGACGAGG - Intergenic
1170771238 20:19334615-19334637 CTTAGGTGGGTTCCTAAAGAAGG + Intronic
1172010326 20:31842634-31842656 CTCAGTTGGGTCAGGGAAGGAGG - Intergenic
1173584274 20:44170246-44170268 GGAAGGTGGTTCCCTGAAGGAGG - Intronic
1175342301 20:58241087-58241109 CAATGGTGGGTCCCTGAAAGAGG + Intergenic
1176074224 20:63241137-63241159 CCCAGGTGGGCACCTGAGGGAGG + Exonic
1176266982 20:64214800-64214822 GTCAGGTGGGCCCCGAAAGGAGG - Intronic
1179292138 21:40028181-40028203 CTCAAGTGGGTCCCTGACCCCGG - Intronic
1179292900 21:40033851-40033873 CTCAAGTGGGTCCCTGACCCCGG + Intronic
1179509343 21:41862178-41862200 GTCACGTGGGTTCCTGCAGGGGG - Intronic
1180089916 21:45528630-45528652 CTCAGGTGGATTCCTGGAAGGGG - Intronic
1180177352 21:46097424-46097446 CTCAGGTGGGGACCTCACGGTGG + Intergenic
1180947386 22:19704059-19704081 CACAGGTGCTTCCCTGCAGGTGG + Intergenic
1182809460 22:33103522-33103544 CTCAGGTTGGTCACTGAGGAAGG + Intergenic
1183227473 22:36560353-36560375 CTCAGGGGGCTCCCTGCAGAGGG - Intergenic
1183408521 22:37641771-37641793 CTCAGAGGGTTTCCTGAAGGAGG + Intronic
1184564180 22:45281897-45281919 CTCAGGTGGGTGGCTGAGGCAGG + Intergenic
1184839434 22:47043878-47043900 CTCAGGTGGGGCCATGTGGGAGG + Intronic
949224893 3:1682347-1682369 CTCAAGTGGGTCCCTGACTCCGG + Intergenic
950590525 3:13933229-13933251 CTGAGGCGGGTCCCTGAGGCGGG - Intergenic
952098559 3:29984886-29984908 CTCAAGTGGGTCCCTCAAGTGGG - Intronic
953093912 3:39756267-39756289 CTCAGGTGGTGCAATGAAGGGGG + Intergenic
953766921 3:45750108-45750130 GTCAGGTGGCTTCCTGGAGGAGG + Intergenic
953907108 3:46873920-46873942 CTCAGATGCCTCCCTGAAGCTGG - Intronic
953967504 3:47321004-47321026 CTGAGGTGTGTGTCTGAAGGAGG + Intronic
954077447 3:48191166-48191188 CCCAGGAGAGTCACTGAAGGTGG + Intergenic
954709885 3:52500316-52500338 CCCAGGTGGTTTCCTGAGGGAGG - Intronic
956481014 3:69674078-69674100 CACAGATGGATTCCTGAAGGAGG + Intergenic
957080431 3:75631929-75631951 CTCTGCAGGCTCCCTGAAGGAGG + Intergenic
957330650 3:78758956-78758978 CGCAGGTGGGTTCCTGGTGGTGG - Intronic
959481073 3:106873295-106873317 CTCAGGTGGGTCCCCAGAGGAGG - Intergenic
962184428 3:133243294-133243316 CACAGGAGAATCCCTGAAGGAGG + Intronic
962414816 3:135172635-135172657 GTCAGGTGTGTCCCTGGAGGAGG + Intronic
963377096 3:144481579-144481601 CTCAGGTAGGTCCTTTTAGGAGG + Intergenic
965604461 3:170484881-170484903 CTCAGGAGACTCCCTGAAGCTGG - Intronic
966309483 3:178577012-178577034 CTCAAGTGGGTCCCTGACCCCGG + Intronic
968231454 3:197007128-197007150 GTGGGGTGGCTCCCTGAAGGTGG + Intronic
968288789 3:197523397-197523419 CTCAGGGGTGTCCCTGAACAGGG + Intronic
968438609 4:609813-609835 CTCAGGTGGGGGCGTGAGGGTGG + Intergenic
969202598 4:5617807-5617829 TGCAGGTGGTTTCCTGAAGGAGG + Intronic
969202636 4:5618046-5618068 CTCAGGTGGGTCAGGGAAAGAGG - Intronic
969718440 4:8879791-8879813 CTCTGGTGGGTCCCTGGCTGTGG - Intergenic
970505536 4:16725689-16725711 TTCAGGTGTGTCCCTGAGAGAGG - Intronic
976194743 4:82521814-82521836 CTCAGGAGGGGGACTGAAGGAGG + Intronic
981859789 4:149341006-149341028 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
986177373 5:5363831-5363853 CCCAGGTGTGTCCCTGCAGTTGG - Intergenic
988532331 5:32038649-32038671 CTTTTATGGGTCCCTGAAGGTGG + Intronic
989030003 5:37109188-37109210 GTCATGTGGCTCCCTGAAGAGGG + Intronic
991105502 5:62837789-62837811 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
994387269 5:99146896-99146918 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
997208115 5:132062153-132062175 CTCAGGTGGGTCCCTGCCCAAGG - Intronic
997340459 5:133140750-133140772 GTCAGGAGAGGCCCTGAAGGTGG + Intergenic
997680436 5:135746420-135746442 CTCACGTGAGTTCCTGGAGGAGG - Intergenic
1000330071 5:160199153-160199175 CTCAGGTAGCTCCGTGAAGCTGG + Exonic
1001756676 5:174175644-174175666 CTCAGCTGTGTGCCTGGAGGAGG + Intronic
1002187030 5:177459282-177459304 CCCAGGTGGGTCAGTGAGGGCGG + Intronic
1002788197 6:419526-419548 CTCAGGAGGGTCCCAGAATGGGG - Intergenic
1003207036 6:4021781-4021803 CTCAGATGGGTCCCCAAAAGAGG - Intronic
1005146795 6:22700949-22700971 TACAGGTGGGTCCTAGAAGGTGG - Intergenic
1005527758 6:26667949-26667971 CTCAGGAGGGACCCTGTGGGAGG - Intergenic
1005543037 6:26833729-26833751 CTCAGGAGGGACCCTGTGGGAGG + Intergenic
1005829358 6:29658253-29658275 GTCAGGTGGCTCCCTGAGGATGG - Intronic
1007989989 6:46245047-46245069 CACATGTGGCTCTCTGAAGGGGG + Intronic
1009013855 6:57875899-57875921 CTCAGGAGGGACCCTGTGGGAGG + Intergenic
1010017779 6:71124443-71124465 CTCAGTGGGGTCTCTGAAAGGGG + Intergenic
1011020628 6:82808963-82808985 CTCAGGTGGGTCCCTAACACTGG - Intergenic
1015050132 6:128830152-128830174 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1015134573 6:129852921-129852943 CTCAGGTAGATCCCTGCAGAGGG + Intronic
1018845518 6:167552574-167552596 CTCAGGGGGCTGCCAGAAGGAGG + Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019538691 7:1541792-1541814 CACAGGAGGGACCCTCAAGGCGG - Exonic
1019706974 7:2501597-2501619 CTCAGGTGAGACCCCAAAGGTGG - Intergenic
1020135541 7:5585973-5585995 CCAAGGTAGGTTCCTGAAGGTGG - Intergenic
1020269018 7:6581178-6581200 CTCACTTTGATCCCTGAAGGAGG - Intronic
1021611356 7:22460787-22460809 CACAGGAGGGTCACTGCAGGAGG - Intronic
1022694578 7:32691784-32691806 GTCAGGTGGGTCCCTGATCCTGG + Intergenic
1023940475 7:44765881-44765903 GTGAGGTGGGTCCCAGAGGGGGG - Intronic
1024528607 7:50371681-50371703 CTCAGCTTGGCCCCTGAGGGTGG - Intronic
1024618466 7:51136229-51136251 CTCAGGGGTGTCCGTGAAGTCGG - Exonic
1027125522 7:75554123-75554145 CTCAGGTGGGGCTCTGAGGCAGG + Exonic
1027191292 7:75997011-75997033 TTAAGGTGGATGCCTGAAGGAGG - Intronic
1028078696 7:86547729-86547751 CTCAAGTGGGTCCCTGACCCTGG - Intergenic
1029089112 7:98034206-98034228 GCCAGGTGGGTCCCTGAGGGTGG + Intergenic
1029672830 7:102045873-102045895 CGCAGCTGGGTCCCTGGAGCGGG - Intronic
1029745587 7:102514225-102514247 CACAGGGGGCTCCCTGGAGGTGG - Intronic
1029763526 7:102613204-102613226 CACAGGGGGCTCCCTGGAGGTGG - Intronic
1032121964 7:129162933-129162955 CTCAGGTGTGACCCAGAGGGAGG + Intronic
1032783996 7:135186375-135186397 CTCAGGTAGGCCACTGAAAGTGG - Intronic
1034028789 7:147737462-147737484 CTCAAGTGGGTCCCTGACCCAGG - Intronic
1035333773 7:158112940-158112962 CTCAGGAGGGTGACTGAAGCTGG + Intronic
1035397882 7:158546934-158546956 CTCACCTGGGGCCCTGAAGATGG - Intronic
1037900134 8:22683365-22683387 GTCAGGTTGGTCCCAGCAGGAGG - Intergenic
1038478739 8:27886935-27886957 CCCAGGAGGGTCCCTGCAGGGGG + Intronic
1038580757 8:28747323-28747345 GACAGGTGGGACCCTGGAGGGGG + Intronic
1039112510 8:34055468-34055490 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1040408656 8:47133650-47133672 AGCAGGAGGGTCCCTGCAGGAGG - Intergenic
1041202231 8:55461176-55461198 CTCAAGTGGGTCCCTGAACCCGG + Intronic
1041872411 8:62649785-62649807 CTCAGGTGAGGCCCAGAAGAGGG - Intronic
1042394554 8:68276989-68277011 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1043537416 8:81221314-81221336 CTCAGCTTGGTCCCTGTTGGTGG + Intergenic
1044546624 8:93467009-93467031 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1048163924 8:132045346-132045368 CTCAGGTGGGTCCCTGAAGGTGG - Intronic
1048413434 8:134199583-134199605 CTTAGGGAGGTCCCAGAAGGAGG - Intergenic
1048542411 8:135354538-135354560 CTCAGGAGTGTCCGTGAAGGTGG - Intergenic
1049964670 9:767408-767430 CTCAAGTGGGTCCCTGACCTCGG + Intergenic
1050374117 9:4953146-4953168 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1052350659 9:27455412-27455434 CTCGGGTGTGGACCTGAAGGCGG - Exonic
1055129827 9:72762319-72762341 CTCTGGTGGGTCCAAGGAGGTGG + Intronic
1057141213 9:92727788-92727810 CCTGGGTGGGGCCCTGAAGGAGG - Intronic
1060520966 9:124293877-124293899 CACAGGTTTCTCCCTGAAGGTGG - Intronic
1062281687 9:135754719-135754741 TTCACCTGGGTCCCTGAAGCCGG - Intronic
1062384558 9:136304016-136304038 CTCAGGTGGGTCATTGAAACTGG + Exonic
1062430647 9:136525565-136525587 CCCAGGTGGGCTCCGGAAGGCGG - Intronic
1062567882 9:137171323-137171345 CCCAGGGGAGTCCCTGGAGGAGG - Intronic
1190358164 X:49625493-49625515 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1190966090 X:55303083-55303105 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1192727553 X:73768592-73768614 CTCATGTGGGTCCCTGACTGCGG + Intergenic
1195445704 X:104950285-104950307 CTCAAGTGGGTCCCTGAGGATGG - Intronic
1199783666 X:151084770-151084792 CTCAGGTGGGCTCCTCCAGGAGG - Intergenic
1200213525 X:154357307-154357329 GTCAGGTGAGTCACTCAAGGGGG + Intronic
1200259453 X:154604895-154604917 CTCAGATGGATTCCTCAAGGTGG + Intergenic
1200259858 X:154608395-154608417 CTCAGATGGATTCCTCAAGGTGG + Intergenic
1200266812 X:154650633-154650655 CTCAGATGGATTCCTCAAGGTGG + Intergenic