ID: 1048164355

View in Genome Browser
Species Human (GRCh38)
Location 8:132049083-132049105
Sequence TTGTTAATGAAGAGGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048164348_1048164355 -6 Left 1048164348 8:132049066-132049088 CCAACAATGCAACCCATTTGTTA 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1048164355 8:132049083-132049105 TTGTTAATGAAGAGGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048164355 Original CRISPR TTGTTAATGAAGAGGGGAAA GGG Intronic
No off target data available for this crispr