ID: 1048164860

View in Genome Browser
Species Human (GRCh38)
Location 8:132053628-132053650
Sequence AGGTCCCTTCTCAGAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048164852_1048164860 21 Left 1048164852 8:132053584-132053606 CCGAAAAGATCAACCAGGATTGC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1048164860 8:132053628-132053650 AGGTCCCTTCTCAGAGGATCTGG No data
1048164855_1048164860 -8 Left 1048164855 8:132053613-132053635 CCCACCTTTTTCCTCAGGTCCCT 0: 1
1: 0
2: 2
3: 41
4: 422
Right 1048164860 8:132053628-132053650 AGGTCCCTTCTCAGAGGATCTGG No data
1048164856_1048164860 -9 Left 1048164856 8:132053614-132053636 CCACCTTTTTCCTCAGGTCCCTT 0: 1
1: 0
2: 2
3: 42
4: 438
Right 1048164860 8:132053628-132053650 AGGTCCCTTCTCAGAGGATCTGG No data
1048164853_1048164860 8 Left 1048164853 8:132053597-132053619 CCAGGATTGCACAAAACCCACCT 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1048164860 8:132053628-132053650 AGGTCCCTTCTCAGAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048164860 Original CRISPR AGGTCCCTTCTCAGAGGATC TGG Intronic
No off target data available for this crispr