ID: 1048171540

View in Genome Browser
Species Human (GRCh38)
Location 8:132111368-132111390
Sequence GACAATGCACTGATTCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048171539_1048171540 -10 Left 1048171539 8:132111355-132111377 CCGTGAACAGAATGACAATGCAC 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG No data
1048171538_1048171540 14 Left 1048171538 8:132111331-132111353 CCTGTGCAATGAGCTGAATAGCA 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG No data
1048171537_1048171540 30 Left 1048171537 8:132111315-132111337 CCAAGGGAGAAAAATGCCTGTGC 0: 1
1: 0
2: 1
3: 22
4: 235
Right 1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048171540 Original CRISPR GACAATGCACTGATTCAGCA TGG Intergenic
No off target data available for this crispr