ID: 1048172716

View in Genome Browser
Species Human (GRCh38)
Location 8:132123050-132123072
Sequence AGGGACACCTTTGGTAAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048172708_1048172716 17 Left 1048172708 8:132123010-132123032 CCAAGCTGTGTTCAAATGAGACC 0: 1
1: 0
2: 1
3: 16
4: 142
Right 1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1048172712_1048172716 -5 Left 1048172712 8:132123032-132123054 CCAGAGATCCCAGTGCAAAGGGA 0: 1
1: 0
2: 6
3: 25
4: 357
Right 1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1048172710_1048172716 -4 Left 1048172710 8:132123031-132123053 CCCAGAGATCCCAGTGCAAAGGG 0: 1
1: 0
2: 2
3: 14
4: 184
Right 1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG 0: 1
1: 0
2: 1
3: 8
4: 140
1048172707_1048172716 18 Left 1048172707 8:132123009-132123031 CCCAAGCTGTGTTCAAATGAGAC 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048172716 Original CRISPR AGGGACACCTTTGGTAAAAC TGG Exonic
905486241 1:38298831-38298853 AGGGACACCTAGGTTAAAAGAGG - Intergenic
906277202 1:44525285-44525307 GGGGCCACCTTTGGCAAAACGGG + Intronic
909101279 1:71352390-71352412 AGGGACAGCATGGGGAAAACTGG - Intergenic
915873612 1:159588423-159588445 TGGGACACCTTTGGTGAAAAAGG + Exonic
917622403 1:176810169-176810191 AGGCCCACCTTTAGGAAAACAGG + Intronic
918625686 1:186653707-186653729 AGGGACACATTTTCTGAAACAGG + Intergenic
919060969 1:192632295-192632317 GGAGACTCCTTTGGTAAAGCAGG + Intergenic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
920688916 1:208130995-208131017 AGGGACATCTTTGTGAACACAGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1062775466 10:142389-142411 AGTGACACCTTTAAAAAAACAGG - Intronic
1063874670 10:10461611-10461633 GGAGACACCTTAGGTAAAATTGG + Intergenic
1067468181 10:46516995-46517017 AGTGACTCCTTTGCGAAAACTGG + Intergenic
1069664296 10:70144769-70144791 GGGGACACCTATGGCAAAACTGG + Intronic
1070448792 10:76536271-76536293 AGAGACACCATTGGGAAAATTGG - Intronic
1071342797 10:84664254-84664276 AAAGGCACCTTTGGGAAAACTGG - Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1072304295 10:94092490-94092512 AGGGACATCTTTGAAAAAATAGG + Intronic
1077949704 11:6943045-6943067 AGTGACACCTTTGATTAAAAAGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081778004 11:45689645-45689667 GGGAACACCTGGGGTAAAACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085173308 11:74466751-74466773 TGGGCCACCATTTGTAAAACGGG - Intronic
1085449423 11:76623003-76623025 AGAGACACCTTTGGAAAATATGG + Intergenic
1091337524 11:134783628-134783650 CGGGACAACTGTGGTAAAACTGG + Intergenic
1093486554 12:19659024-19659046 AGGGAGACCCCTGGGAAAACTGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095592751 12:43922498-43922520 AGTGACACATTTGGTAAATTTGG + Intronic
1097473610 12:60026146-60026168 ATGTACATTTTTGGTAAAACTGG + Intergenic
1099055919 12:77840495-77840517 AGGGACAAATCTAGTAAAACAGG + Intronic
1100661361 12:96702344-96702366 AGGGACACATTTGGGAATGCTGG + Intronic
1101191264 12:102335906-102335928 ATGGACATCTTTGGTAATAATGG + Intergenic
1107887095 13:44882703-44882725 AGGGACAACTTTATTAAAAGGGG - Intergenic
1112474949 13:99722915-99722937 AGGCACACTTTTCTTAAAACAGG - Intronic
1119479664 14:74951628-74951650 ATGGCCACCTTTGGCAGAACTGG + Intronic
1126036892 15:44554655-44554677 AAGGAAACTTTTGGTAAGACGGG + Exonic
1127027899 15:54828349-54828371 AGGGACATCAGTGGAAAAACTGG + Intergenic
1127536220 15:59892425-59892447 AGGCCCAGCTTTGGTAATACTGG - Intergenic
1128040331 15:64566744-64566766 AGGGTCACCCAAGGTAAAACTGG - Intronic
1134646440 16:15871342-15871364 AGGGACACCTTCTATAAAAAGGG + Intronic
1135656328 16:24253587-24253609 AGGGATACATGTGATAAAACTGG - Intergenic
1136133857 16:28242156-28242178 AGGGAGACCTTTAGCAAAGCCGG - Intergenic
1136630194 16:31485475-31485497 AGGGACAACATTGGGAAAAACGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1141648610 16:85380455-85380477 AGGGAACCATTTGGTGAAACAGG + Intergenic
1144264489 17:13555048-13555070 TGGGACACCATTGGTGAAAATGG - Intronic
1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG + Intergenic
1151692789 17:75697146-75697168 AGGAAAGCCTTTGGAAAAACAGG - Intronic
1152457227 17:80423428-80423450 AGGGAAGCTTTTGGTAAGACTGG + Intronic
1153187686 18:2502896-2502918 AGGGAGAACTTTGATAAGACAGG - Intergenic
1154300890 18:13191581-13191603 AGGGACACATTGGGTACATCAGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1160161833 18:76479459-76479481 AGGGACACCTTTGGACAATGGGG - Intronic
1162637681 19:11983166-11983188 AGGGAAAACTTTGATAAATCAGG + Intergenic
1164381112 19:27737799-27737821 AGGGACACCTGTGCAAAACCAGG - Intergenic
1164787861 19:30949705-30949727 ATGGAAACATTTGGTAAAATTGG - Intergenic
1164886638 19:31783920-31783942 AGGAACACCTGTGGAAGAACAGG + Intergenic
1166303561 19:41925356-41925378 AGGGACAGGTGTGGGAAAACAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167596130 19:50429080-50429102 AGGGACACCCTTGTTATATCTGG + Exonic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
932835040 2:75028181-75028203 AAGGACAACTATGGTATAACAGG - Intergenic
938605316 2:132886486-132886508 AGGGACACCTGAGGGACAACTGG - Intronic
939648564 2:144733149-144733171 AGTGACACATTTCTTAAAACAGG + Intergenic
940297803 2:152146487-152146509 AGGGATAGCTTTAGTAGAACTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943726474 2:191256545-191256567 AGGGACCCCTTTGGAAAATATGG + Intronic
945573472 2:211500852-211500874 AGTGACTCCTTTGGTATAATAGG + Intronic
947393256 2:229661805-229661827 AGTGACCCCTTTGAAAAAACTGG + Intronic
1173450419 20:43158717-43158739 AAGGACACCTTGTGTAAAATAGG + Intronic
1174736567 20:52971558-52971580 AGGTAGACCTTTGGGAAAAGGGG + Intergenic
1175536695 20:59719808-59719830 AGGGTCATCATTTGTAAAACGGG - Intronic
1181006828 22:20017460-20017482 AGGGACCCCCTCGGTAAACCAGG + Intronic
949188917 3:1227662-1227684 ACAGCTACCTTTGGTAAAACTGG + Intronic
954694368 3:52413063-52413085 AGGGACAGCACTGGTAAGACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
966608793 3:181847858-181847880 AGGCAAACCATTGGTGAAACAGG - Intergenic
968545809 4:1197409-1197431 AGGTAGCCCTTGGGTAAAACAGG + Intronic
969358791 4:6648058-6648080 AGGGACACCACTGGGAAAGCAGG + Intergenic
973191474 4:47390710-47390732 AAGAAAACCTTTGGTAAAATAGG + Intronic
973302082 4:48597440-48597462 AGTGATACATTTGTTAAAACTGG - Intronic
974633423 4:64526599-64526621 TGGGACACCTCTGGTAGAAATGG + Intergenic
975614397 4:76231963-76231985 CGGGACACAATTGGAAAAACTGG - Intronic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
978177569 4:105752071-105752093 TAGGACAGCTTTGGTAAAATGGG + Intronic
980419717 4:132544267-132544289 AAAGAAACCTTTGGGAAAACTGG + Intergenic
986664130 5:10085238-10085260 AGGGACACCTGAAGGAAAACTGG + Intergenic
987428906 5:17807299-17807321 AGGGTCACCTTTGGAAACAACGG + Intergenic
989838164 5:46022254-46022276 ATGGATACCTTTGGTGAAAAAGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
999816509 5:155182190-155182212 AGTGACACCTTTGAGAAAATGGG - Intergenic
1000694542 5:164363836-164363858 AGGGAGACCTATGGGAAGACAGG - Intergenic
1003073320 6:2961533-2961555 AGAGAAACAATTGGTAAAACAGG + Intronic
1005456308 6:26022927-26022949 AGGGCCACCTGTGCTAAACCTGG + Intergenic
1006360350 6:33584036-33584058 GGGGACGCCTCTGGGAAAACAGG + Intergenic
1007206682 6:40158260-40158282 AGGGACACCTATGCAAAGACAGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011602865 6:89076190-89076212 AGGGACACCTGTGTGAAAAGAGG - Intergenic
1013732991 6:113191165-113191187 AAGGAAACCTTTGGTTAAAATGG - Intergenic
1013888823 6:115001448-115001470 AGGGACACATTAGCTAAAGCAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015628989 6:135212019-135212041 AGGGACATCTTTTGAAAAAATGG - Intronic
1018613946 6:165668297-165668319 ATGGACACCTTTTGTACAAATGG + Intronic
1023782263 7:43668033-43668055 CAGGACACAATTGGTAAAACTGG + Intronic
1024515495 7:50250806-50250828 AGGAACACCCTTTGTAACACTGG - Intergenic
1024879485 7:54069378-54069400 AGGGACATCAGTGGAAAAACTGG + Intergenic
1026292797 7:69023747-69023769 AGGTAAATCTTTGGAAAAACTGG - Intergenic
1028344589 7:89763627-89763649 AGGGACACTGTTGGCAATACTGG - Intergenic
1029199430 7:98828708-98828730 GAGGACATCTTTGCTAAAACTGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032961037 7:137034607-137034629 ATGGACAACTTTGATAAAACAGG + Intergenic
1033040191 7:137910337-137910359 AGGGACCTCTTTGGCAAGACTGG - Intronic
1036769147 8:11566829-11566851 AGGGTCACCTTGGGTAGAATGGG + Intergenic
1038820857 8:30950877-30950899 AGGGACACCTGAGATAAAGCTGG + Intergenic
1043150102 8:76704837-76704859 AGGGACATCTTTGGACACACAGG - Exonic
1045666923 8:104497859-104497881 AGTGTAAACTTTGGTAAAACGGG + Exonic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1047399688 8:124535478-124535500 AGGGACATTTTTGGAACAACAGG + Intronic
1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG + Exonic
1050635529 9:7608285-7608307 AGGAAGACCTTTTGTAATACTGG - Intergenic
1052874951 9:33551800-33551822 AAGGACAGCATGGGTAAAACTGG - Intronic
1055101952 9:72475272-72475294 AGGGATACTTAAGGTAAAACAGG - Intergenic
1057680471 9:97177023-97177045 AAGGACAGCATGGGTAAAACTGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060859756 9:126944773-126944795 AGGGACACTGTGGGGAAAACTGG - Intronic
1186654023 X:11593617-11593639 AGTGATACCTTTGTTACAACTGG - Intronic
1187047537 X:15662190-15662212 AGGGAAACCATTGGGAAAAATGG - Intronic
1187199737 X:17123551-17123573 AGGAACAACTTTGGTGAAAGTGG - Intronic
1190075871 X:47316810-47316832 AGGGAAAATTTTGGTTAAACAGG - Intergenic
1190142226 X:47857843-47857865 AGGGACACATTTCCTCAAACTGG + Intronic
1190281887 X:48936595-48936617 ATGCACACCTTTGATAAATCTGG - Intronic
1190723018 X:53166728-53166750 CGGGACACAATTGGAAAAACTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193261574 X:79412872-79412894 AGGAACACCTTTTGTAAAACTGG - Intergenic
1197097064 X:122609512-122609534 AGGGACACAACTAGTAAAACAGG - Intergenic
1197715035 X:129700509-129700531 ATGGTCACCTTTGGGAAAAAGGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198855678 X:141013393-141013415 CGGGACACGATTGGAAAAACTGG + Intergenic
1198876453 X:141232746-141232768 CGGGACACGATTGGAAAAACTGG - Intergenic
1198907016 X:141573975-141573997 CGGGACACGATTGGAAAAACTGG - Intergenic
1198909779 X:141600483-141600505 CGGGACACGATTGGAAAAACTGG + Intronic
1198917307 X:141687656-141687678 CGGGACACGATTGGAAAAACTGG - Intronic
1199490851 X:148398996-148399018 AGAGACAGATTTGATAAAACTGG - Intergenic