ID: 1048173360

View in Genome Browser
Species Human (GRCh38)
Location 8:132129554-132129576
Sequence GGGGAGATTCGGTCCGAGTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048173360 Original CRISPR GGGGAGATTCGGTCCGAGTA GGG Exonic
910796351 1:91101508-91101530 GGGGAGTTTCGGTTGGACTAAGG + Intergenic
915246234 1:154558278-154558300 GGGGAGATGCGGTCCGGGCGCGG + Exonic
1066421363 10:35267554-35267576 GGGTAGATTTGGTCTGAGTCTGG + Intronic
1083943663 11:65912073-65912095 GGGCAGACTCGGTCGGAGGAGGG + Intergenic
1141775915 16:86122434-86122456 GCGGGGATTCGGACAGAGTAAGG - Intergenic
1153285353 18:3450850-3450872 GGGGATATGGGGTCCGAGTAGGG + Intronic
1160707670 19:536986-537008 GGGGAGAGTGGGTCGGAGTGGGG - Intronic
1162745103 19:12793640-12793662 GGGCAGAATCGGTCCTTGTATGG - Intronic
1164976236 19:32574761-32574783 GGGGATATTTGGTCCAAGCACGG - Intergenic
933937069 2:87215115-87215137 GGGGAGATTTGGTCCTATTCTGG + Intergenic
936356072 2:111750709-111750731 GGGGAGATTTGGTCCTATTCTGG - Intergenic
961081419 3:124032423-124032445 GCGGAGATACGGGCCAAGTACGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
990987713 5:61655974-61655996 GGGTAGATTCGGACAGAGCAGGG + Intronic
1001599047 5:172917053-172917075 GGGGAGATGTGGTCGGATTAGGG + Intronic
1006336809 6:33425304-33425326 GGGGAGGTTGGGTCCCAGTCTGG + Intronic
1008667415 6:53729679-53729701 GGGGAGATCAGGGCTGAGTAAGG + Intergenic
1023706575 7:42947519-42947541 GGGGAGATTCAGTCCTAGGAGGG - Intronic
1032191614 7:129769175-129769197 GGGGAGACACAGGCCGAGTAGGG - Intergenic
1035240795 7:157527932-157527954 GGGTGGAATCGGTGCGAGTACGG - Intergenic
1048173360 8:132129554-132129576 GGGGAGATTCGGTCCGAGTAGGG + Exonic
1052866530 9:33467651-33467673 GGGGAGTTTGGGTCTGAGTTGGG - Intronic