ID: 1048175609

View in Genome Browser
Species Human (GRCh38)
Location 8:132149632-132149654
Sequence CTCCAGTATTGTATTGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048175609_1048175624 28 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175609_1048175621 19 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175621 8:132149674-132149696 AGGGCCACAGACACGCGCGCGGG No data
1048175609_1048175623 27 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175623 8:132149682-132149704 AGACACGCGCGCGGGACAGTTGG No data
1048175609_1048175620 18 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175620 8:132149673-132149695 AAGGGCCACAGACACGCGCGCGG No data
1048175609_1048175613 0 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175613 8:132149655-132149677 GTGGTCCACACCCACCCCAAGGG No data
1048175609_1048175612 -1 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175612 8:132149654-132149676 GGTGGTCCACACCCACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048175609 Original CRISPR CTCCAGTATTGTATTGTAAA AGG (reversed) Intronic