ID: 1048175612

View in Genome Browser
Species Human (GRCh38)
Location 8:132149654-132149676
Sequence GGTGGTCCACACCCACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048175609_1048175612 -1 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175612 8:132149654-132149676 GGTGGTCCACACCCACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048175612 Original CRISPR GGTGGTCCACACCCACCCCA AGG Intronic