ID: 1048175614

View in Genome Browser
Species Human (GRCh38)
Location 8:132149660-132149682
Sequence TGTGGCCCTTGGGGTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048175614_1048175625 5 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175625 8:132149688-132149710 GCGCGCGGGACAGTTGGGCCAGG No data
1048175614_1048175621 -9 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175621 8:132149674-132149696 AGGGCCACAGACACGCGCGCGGG No data
1048175614_1048175624 0 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175614_1048175623 -1 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175623 8:132149682-132149704 AGACACGCGCGCGGGACAGTTGG No data
1048175614_1048175620 -10 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175620 8:132149673-132149695 AAGGGCCACAGACACGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048175614 Original CRISPR TGTGGCCCTTGGGGTGGGTG TGG (reversed) Intronic