ID: 1048175620

View in Genome Browser
Species Human (GRCh38)
Location 8:132149673-132149695
Sequence AAGGGCCACAGACACGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048175614_1048175620 -10 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175620 8:132149673-132149695 AAGGGCCACAGACACGCGCGCGG No data
1048175609_1048175620 18 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175620 8:132149673-132149695 AAGGGCCACAGACACGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048175620 Original CRISPR AAGGGCCACAGACACGCGCG CGG Intronic