ID: 1048175621 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:132149674-132149696 |
Sequence | AGGGCCACAGACACGCGCGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048175609_1048175621 | 19 | Left | 1048175609 | 8:132149632-132149654 | CCTTTTACAATACAATACTGGAG | No data | ||
Right | 1048175621 | 8:132149674-132149696 | AGGGCCACAGACACGCGCGCGGG | No data | ||||
1048175614_1048175621 | -9 | Left | 1048175614 | 8:132149660-132149682 | CCACACCCACCCCAAGGGCCACA | No data | ||
Right | 1048175621 | 8:132149674-132149696 | AGGGCCACAGACACGCGCGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048175621 | Original CRISPR | AGGGCCACAGACACGCGCGC GGG | Intronic | ||