ID: 1048175624

View in Genome Browser
Species Human (GRCh38)
Location 8:132149683-132149705
Sequence GACACGCGCGCGGGACAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048175615_1048175624 -5 Left 1048175615 8:132149665-132149687 CCCACCCCAAGGGCCACAGACAC No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175614_1048175624 0 Left 1048175614 8:132149660-132149682 CCACACCCACCCCAAGGGCCACA No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175618_1048175624 -10 Left 1048175618 8:132149670-132149692 CCCAAGGGCCACAGACACGCGCG No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175617_1048175624 -9 Left 1048175617 8:132149669-132149691 CCCCAAGGGCCACAGACACGCGC No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175609_1048175624 28 Left 1048175609 8:132149632-132149654 CCTTTTACAATACAATACTGGAG No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data
1048175616_1048175624 -6 Left 1048175616 8:132149666-132149688 CCACCCCAAGGGCCACAGACACG No data
Right 1048175624 8:132149683-132149705 GACACGCGCGCGGGACAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048175624 Original CRISPR GACACGCGCGCGGGACAGTT GGG Intronic