ID: 1048176521

View in Genome Browser
Species Human (GRCh38)
Location 8:132157526-132157548
Sequence ACACTCTCCCAGCCAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 5, 3: 21, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048176521_1048176522 5 Left 1048176521 8:132157526-132157548 CCAGTGGCTGGCTGGGAGAGTGT 0: 1
1: 1
2: 5
3: 21
4: 273
Right 1048176522 8:132157554-132157576 CTGTCCCTGTGCTGTTTCCAAGG No data
1048176521_1048176525 15 Left 1048176521 8:132157526-132157548 CCAGTGGCTGGCTGGGAGAGTGT 0: 1
1: 1
2: 5
3: 21
4: 273
Right 1048176525 8:132157564-132157586 GCTGTTTCCAAGGACACACTTGG No data
1048176521_1048176526 20 Left 1048176521 8:132157526-132157548 CCAGTGGCTGGCTGGGAGAGTGT 0: 1
1: 1
2: 5
3: 21
4: 273
Right 1048176526 8:132157569-132157591 TTCCAAGGACACACTTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048176521 Original CRISPR ACACTCTCCCAGCCAGCCAC TGG (reversed) Intronic
900349274 1:2227298-2227320 ACACTCGGCCACCGAGCCACCGG + Intergenic
900470091 1:2849364-2849386 CCACACTCCCACCCAGGCACAGG - Intergenic
900470133 1:2849522-2849544 CCACACTCCCACCCAGGCACAGG - Intergenic
900594797 1:3475868-3475890 ACACCTGCCCAGCCAGCCTCTGG - Intronic
900726610 1:4220438-4220460 ACACTCTCCCGGCAAAGCACCGG - Intergenic
900842500 1:5065759-5065781 ACACTCCCCCATCTACCCACAGG - Intergenic
900926792 1:5711040-5711062 ACACACTCCAACCAAGCCACAGG - Intergenic
903953907 1:27012141-27012163 CCCCTCTCCCAGCCAGGCCCTGG + Intronic
904499809 1:30907590-30907612 ACAGTGGCCCAGCCAGGCACAGG + Intronic
905343475 1:37295339-37295361 AGACTCTCACAGCCACCCCCAGG - Intergenic
906095743 1:43222808-43222830 ACTCTCTCTGAGCCAGGCACAGG + Intronic
908169541 1:61491155-61491177 CCACTCTCCCACTCATCCACCGG - Intergenic
910096508 1:83528523-83528545 ACACTCTCCATGCCTTCCACAGG + Intergenic
912965045 1:114229967-114229989 ACAGTTTTCCAGCCTGCCACTGG + Intergenic
913960047 1:143332541-143332563 ACACTCTCAGAGACAGGCACGGG - Intergenic
914054402 1:144158114-144158136 ACACTCTCAGAGACAGGCACGGG - Intergenic
914124744 1:144808247-144808269 ACACTCTCAGAGACAGGCACGGG + Intergenic
915107744 1:153544951-153544973 ACACCCTCCCAGCCAGGTGCGGG - Intronic
915526310 1:156478449-156478471 ACAGTCACCCAGCCAGACAATGG + Intronic
916373596 1:164126743-164126765 AGACCCTCCGAGCCAGGCACAGG + Intergenic
917535517 1:175871860-175871882 ATACCCTCCCAACCAGCCTCAGG + Intergenic
918220021 1:182428242-182428264 AGTCTCACCCTGCCAGCCACAGG - Intergenic
919697367 1:200591628-200591650 ACACTCTCCCAGTCTTCCTCTGG + Intronic
919924322 1:202184686-202184708 ACACCCACCCACCCACCCACAGG + Intergenic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
920723861 1:208415471-208415493 AAACTCACCCATCTAGCCACAGG + Intergenic
921925244 1:220705704-220705726 GCCCTCTCCCTGCCAGCCCCTGG - Intergenic
922537019 1:226388981-226389003 ATACTCTCCCAGCCAGGGAGAGG + Intronic
922764747 1:228150997-228151019 ACACACTCCCAGCCTGACCCAGG + Intronic
1063116620 10:3076331-3076353 ACACTGTCCCAGCCACGCAGAGG + Intronic
1063824484 10:9878668-9878690 ACGCTCTCCCACGCCGCCACGGG - Intergenic
1064564386 10:16625249-16625271 ACTCTCTCCCAGTCACCAACTGG + Intronic
1066158629 10:32704799-32704821 GCACTCTCCGAGCCAGGCGCGGG + Intronic
1067028453 10:42864593-42864615 ACACTCTCAGAGACAGGCACGGG - Intergenic
1067845314 10:49715267-49715289 GCACCCTCCGAGCCAGGCACAGG - Intergenic
1068966705 10:62919093-62919115 ACACTTACCCAGCCAGGCACTGG + Intronic
1070501697 10:77078741-77078763 GCACTCTCCCTGACACCCACAGG - Intronic
1070505479 10:77109171-77109193 AGACCCATCCAGCCAGCCACAGG - Intronic
1071244417 10:83746990-83747012 GCACCCTCCAAGCCAGGCACAGG + Intergenic
1071522006 10:86337292-86337314 CCACTCTCCCAGGCAGCCTTTGG - Intronic
1073753012 10:106550958-106550980 ACACTCTCCCAGACACACCCAGG + Intergenic
1074358217 10:112804329-112804351 CCACCTTCCCATCCAGCCACTGG + Intronic
1075326664 10:121538141-121538163 ACCTTTTTCCAGCCAGCCACAGG + Intronic
1076589784 10:131575091-131575113 CCGCTCTCCGGGCCAGCCACTGG + Intergenic
1076784994 10:132745348-132745370 ACACACTCCCAGGCAGACAAGGG - Intronic
1076848563 10:133081965-133081987 ACAGTGTCCCCGCCAGCCAGTGG - Intronic
1077231501 11:1459938-1459960 ACCCTCTCCCTGTCATCCACTGG + Intronic
1077636640 11:3846288-3846310 TCCCTCTCTCAGCCAGCCTCAGG + Intergenic
1078007303 11:7541561-7541583 ACACTCCACCATGCAGCCACCGG - Intronic
1078947935 11:16092418-16092440 TCACTCACCCAGTCAGTCACTGG - Intronic
1079535103 11:21504677-21504699 ACATTCTCCCTGGAAGCCACAGG - Intronic
1081854141 11:46293409-46293431 TCATTTTCCCAGCCAGCCCCTGG - Intronic
1082069127 11:47924528-47924550 ACACACCTCCAGCCAGCCAGTGG + Intergenic
1082999953 11:59282284-59282306 ACACCCTCACAGGCACCCACAGG - Intergenic
1083270503 11:61569889-61569911 ACACCCTCCTACGCAGCCACAGG + Intronic
1083281817 11:61631486-61631508 TCTCCCTCCCAGCCAGCCCCTGG + Intergenic
1083325280 11:61869918-61869940 CCACTCCTCCAGCCAGCCGCTGG - Intergenic
1083349686 11:62018606-62018628 GCATGCACCCAGCCAGCCACAGG + Intergenic
1083969320 11:66063773-66063795 ACAGTCAGCCAGCCAGCCAAAGG - Intronic
1084368975 11:68725502-68725524 TCACCCTCTCAGCAAGCCACAGG - Intronic
1084509825 11:69596618-69596640 ACACTCTCCTTGCCAGACACAGG + Intergenic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1090229628 11:125092352-125092374 ACACTCGCCCAGCCTCCCAGTGG - Intergenic
1090383078 11:126340201-126340223 GCACTCTGGCTGCCAGCCACAGG + Intronic
1090394246 11:126408320-126408342 TCACCCTCATAGCCAGCCACTGG - Exonic
1090736723 11:129617404-129617426 ACACACACCCTCCCAGCCACAGG + Intergenic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1091301148 11:134509032-134509054 TCACCCGCTCAGCCAGCCACTGG + Intergenic
1092048574 12:5451404-5451426 ACACTCTTGCACCCAGCCAGTGG + Intronic
1092427300 12:8385182-8385204 ACACTCCCCAAACCAGGCACCGG + Intergenic
1092784962 12:12018378-12018400 CCACTCTGCCAGCCAGGCCCAGG + Intergenic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1093819863 12:23601125-23601147 ACACTCCCCAAGCCACCAACTGG + Intronic
1094346698 12:29477732-29477754 AAACTCTACCAGACAACCACTGG + Intronic
1095955891 12:47805768-47805790 ACAGCCACCCAGCCAGCCAGTGG + Intronic
1095961766 12:47839395-47839417 AGATTCCCCCTGCCAGCCACAGG + Intergenic
1095970818 12:47901056-47901078 ATCCTCTCCCAGCCAGCCTTGGG + Intronic
1096497155 12:52045272-52045294 CCACCCTCCCTGCCAGCCCCAGG + Intronic
1101606220 12:106248624-106248646 TCACTCTCCCAGCCCGCCATGGG + Intronic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1103024518 12:117562788-117562810 ACACTCTTCCTTCCAGCCAGGGG + Intronic
1104639157 12:130456427-130456449 ACACCCTCGCAGGCAGCCAACGG + Intronic
1104822003 12:131682492-131682514 CCCCTCCCCCAGGCAGCCACTGG + Intergenic
1104966022 12:132509185-132509207 GGCCGCTCCCAGCCAGCCACTGG + Intronic
1106434375 13:29710843-29710865 GTAGGCTCCCAGCCAGCCACAGG + Intergenic
1108515716 13:51200698-51200720 AAACTCTCCAGGCCAGCCAGAGG + Intergenic
1110943494 13:81383562-81383584 AGACTCTCTCAACCAGCTACTGG + Intergenic
1113914001 13:113860391-113860413 ACAGGCTCCCAGGCAGGCACCGG + Intronic
1114576766 14:23722019-23722041 ACCCTCTGCCAGGCAGCCATTGG - Intergenic
1115077936 14:29414086-29414108 GGACTCTCCCAGCCAGGCACGGG - Intergenic
1117892646 14:60443372-60443394 GCACTCACCGAGCCAGGCACGGG - Intronic
1118483372 14:66189515-66189537 GGACCCTCCCAGCCAGGCACGGG + Intergenic
1119145966 14:72314416-72314438 ACACTTTCTCAGGCATCCACTGG + Intronic
1119670967 14:76518010-76518032 ACATTGTCCCACCCAACCACAGG - Intergenic
1120416985 14:84231817-84231839 ACACGCTCCCTGCAGGCCACTGG + Intergenic
1122409661 14:101519314-101519336 AGTCCCTCCCAGCCAGCCACGGG - Intergenic
1122474036 14:101993441-101993463 ACACGGGCCCAGCAAGCCACTGG - Intronic
1122549704 14:102543397-102543419 CCATGCTCCCACCCAGCCACCGG - Intergenic
1122900335 14:104779749-104779771 ACCCCCGCCCAGCCAGCCTCAGG + Intronic
1126239481 15:46425263-46425285 GGACTCTCTCAGCCAGGCACAGG - Intergenic
1128746355 15:70117109-70117131 ACAGTCACACAGCCAGCCAGCGG - Intergenic
1132089045 15:98932992-98933014 AGCCTCTCACATCCAGCCACAGG + Intronic
1132462723 16:63354-63376 ATGCTCTCCCATCCAGACACTGG + Intronic
1135903598 16:26489911-26489933 AAACTCACCCAGCCTGCCCCAGG + Intergenic
1135973382 16:27088488-27088510 ACATGCTCCCAGCCAGGCCCAGG + Intergenic
1137317942 16:47347399-47347421 AGACCCTCCCAGCCATGCACAGG - Intronic
1137324611 16:47421826-47421848 ACAGTCCCCCACCCAGCAACAGG + Intronic
1137400848 16:48153515-48153537 ACTCACTCCCAGCCACCCAGTGG + Intronic
1137405966 16:48189720-48189742 ACACTTTCCCACCCGGCCTCTGG - Intronic
1137933665 16:52612554-52612576 ACACTCTGCCAGAAAGACACAGG - Intergenic
1138315207 16:56063984-56064006 ACCCTTACCCAGCCAGCCTCAGG + Intergenic
1138497494 16:57417059-57417081 TCACTCTCCCAACCAGCGATGGG + Intergenic
1139080027 16:63506186-63506208 ACATTCTCCCAGCACCCCACAGG + Intergenic
1140249912 16:73286949-73286971 ACACTCACACAGCCACACACTGG - Intergenic
1140415415 16:74770744-74770766 ACACTAGCCCAGCCCTCCACTGG - Intronic
1141615996 16:85209712-85209734 AGACTCTCCCTCCCAGCCTCGGG - Intergenic
1141985565 16:87577502-87577524 ACCCTCTCCCACTCATCCACTGG + Intergenic
1142258212 16:89025916-89025938 GCACTCTCTCAGCCAGCAAAGGG + Intergenic
1142557564 17:790196-790218 CCACTCTCCCAGCCCGCCCGTGG + Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1142711592 17:1726674-1726696 ACACTCACCTGGCCAGCTACGGG + Exonic
1142992038 17:3737917-3737939 CCAACCTCCCAGCCAGCTACTGG - Intronic
1143899439 17:10162828-10162850 TCCCTCTCCCCGCCAGCCCCTGG - Intronic
1144789437 17:17849278-17849300 ACCCACTCACTGCCAGCCACAGG + Intronic
1145025444 17:19464841-19464863 ACTCTGTCCAAGCCAGGCACAGG - Intergenic
1145285535 17:21503552-21503574 CCCCTCACCCAGCTAGCCACAGG - Intergenic
1146002428 17:29139348-29139370 ACTCTCCCCCAGCCACCCCCGGG - Intronic
1147768666 17:42853060-42853082 ACTCTCTCCCATCCAGCAAAAGG - Intronic
1151435024 17:74089856-74089878 ACAGCCTCCCAGCCAGTCGCAGG - Intergenic
1152738322 17:82008217-82008239 GCAGTCTCCCACCCAGCCACGGG - Intronic
1152859778 17:82689426-82689448 AGCCTCTCCCAGCCTGTCACTGG + Intronic
1153568782 18:6447261-6447283 AGACCCTCCCAGCCACCCACAGG - Intergenic
1154011730 18:10580254-10580276 ATAATCTCCCCTCCAGCCACAGG + Intergenic
1155372959 18:25122930-25122952 ACACGCACTCAGCCAGTCACAGG + Intronic
1156421620 18:36960158-36960180 ACACCCACCCAGCCAGACACAGG - Intronic
1156493570 18:37511206-37511228 TCACTCACCCATCCTGCCACAGG + Intronic
1159592341 18:70348731-70348753 GCACCCTCCAAGCCAGGCACAGG + Intronic
1160068814 18:75606411-75606433 ACATTCTCCCTGCCATCCCCAGG + Intergenic
1160683687 19:423741-423763 TCCCCCTCCCAGCCAGCGACTGG + Intronic
1160725181 19:614671-614693 AAACTCTCCCTGCCGCCCACTGG - Intronic
1160868049 19:1264754-1264776 CCACTCTCCCAGGCAGCTGCAGG - Intronic
1161044319 19:2126991-2127013 ACGGACTCCCAGCCAGCCCCAGG + Intronic
1161194001 19:2976100-2976122 AGTCTCTCTCAGACAGCCACCGG - Intergenic
1161232393 19:3180775-3180797 ACACGCTCCCCGCCAGCCACAGG + Intergenic
1161504205 19:4635480-4635502 ACACCCACCCACCCACCCACAGG + Intergenic
1161644657 19:5445662-5445684 ACAGCCTCCCAGCCAGGCCCAGG - Intergenic
1162734407 19:12738074-12738096 AGACTGTCCCAGGCAGCTACAGG + Intronic
1163600879 19:18248350-18248372 ACACTCTGCCCTCCACCCACTGG - Intronic
1163676755 19:18659259-18659281 CCTCTCTCCCAGCCAGTCCCAGG - Intronic
1164372860 19:27656924-27656946 AGAAACTCCCAGCCAGCCACAGG - Intergenic
1164465868 19:28487105-28487127 AAACAGTCCCTGCCAGCCACAGG - Intergenic
1168291837 19:55360957-55360979 ACCTTCTCCCACCCACCCACCGG + Intronic
1168644706 19:58052614-58052636 AGACTCACCCAGCAAGCCAGGGG - Exonic
1202693881 1_KI270712v1_random:110792-110814 ACACTCTCAGAGACAGGCACGGG - Intergenic
925206703 2:2013385-2013407 ACACCTGCCCATCCAGCCACTGG + Intronic
925402870 2:3588246-3588268 ACAGTCTCCCAGCCAGATACAGG + Intergenic
925609598 2:5692308-5692330 TCACTCCCCCAGCTAGCCAATGG - Intergenic
926148394 2:10411057-10411079 ACACACTCCCAGTCACTCACTGG - Intronic
926731898 2:16041869-16041891 ACCCTCCTCCAGCCAACCACAGG - Intergenic
927488252 2:23503981-23504003 GCACTCTCCAAGCCAGCCAGAGG + Intronic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
930001317 2:46863550-46863572 GCCTTCTCCCAGCCAGCCTCGGG - Intergenic
930730324 2:54723196-54723218 ACGGTCTCCCAGCCCACCACTGG - Intergenic
933952680 2:87343783-87343805 ACACTCTCAGAGACAGGCACGGG + Intergenic
934236922 2:90240129-90240151 ACACTCTCAGAGACAGGCACGGG + Intergenic
934997426 2:98978161-98978183 GGACCCTCCCAGCCAGGCACAGG - Intergenic
937080759 2:119137940-119137962 AAACCCTCCCTGCTAGCCACAGG - Intergenic
937370047 2:121291044-121291066 ACAGTATTCCTGCCAGCCACAGG + Intergenic
937443155 2:121933984-121934006 ACACTCTGCCAGACAGCCCATGG + Intergenic
938092913 2:128444807-128444829 ACTCTGCCCCAGCCAACCACAGG - Intergenic
938801453 2:134767032-134767054 CCATTCACTCAGCCAGCCACTGG + Intergenic
940008299 2:149029859-149029881 ACAATCCCCCAGCCAGCCGGTGG - Intergenic
943049914 2:182901931-182901953 ACACTCGCACAGGCAGACACAGG + Intergenic
943787059 2:191889305-191889327 CCACTCTCTCAGTCAGGCACTGG + Intergenic
944450189 2:199834571-199834593 AGACTAACCCAGCCAGTCACAGG - Intronic
945937567 2:215918513-215918535 GCTCTCTCCCAGCCTGTCACTGG + Intergenic
946043908 2:216805078-216805100 CAACTCTCCCAGTCAGCCAAAGG - Intergenic
948091364 2:235298863-235298885 CCACTCTCCAACCCAGTCACTGG - Intergenic
1168755447 20:313835-313857 ACCCTCTCCCCGCCAAACACTGG + Intergenic
1169111396 20:3036508-3036530 CCAGTTTCCCAGGCAGCCACAGG + Intronic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1171498042 20:25571104-25571126 ATCCTCACCCAGCCAGCCATCGG - Intronic
1173841130 20:46157970-46157992 ACCCTCTTCCAGCCAGACAGTGG + Intergenic
1174744589 20:53048812-53048834 ACACACCTCCAGCCACCCACTGG + Intronic
1175199547 20:57267847-57267869 CCACTCTCTCACCCAGCCCCAGG - Intergenic
1175552143 20:59824464-59824486 AGGCTCTCCCAGCCAGACTCTGG - Intronic
1176045132 20:63088579-63088601 ACCCTCTCCCAGCAAGCTCCGGG - Intergenic
1176090299 20:63315585-63315607 ACCACCGCCCAGCCAGCCACAGG - Intronic
1178388720 21:32180917-32180939 CCCTTCTCCCAGTCAGCCACTGG - Intergenic
1178888627 21:36501783-36501805 CCAGGCTCCCAGCCAGCCCCTGG + Intronic
1179077823 21:38140640-38140662 ACACCCTGACAGCCAGCAACAGG - Intronic
1179728836 21:43356049-43356071 CCTCACTCCCAGCCAGCCAGGGG + Intergenic
1180600221 22:17010589-17010611 AGACCCTCCCCGACAGCCACCGG - Intergenic
1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1181221151 22:21365225-21365247 ACACCCTCCCAGCCAGCCGCTGG - Intergenic
1181374696 22:22447652-22447674 ACAGTCAGCCAGCCAGTCACTGG - Intergenic
1181449930 22:23012926-23012948 ACACTCACCCCAACAGCCACGGG - Intergenic
1182905687 22:33934208-33934230 TCACTCTCCCAGCCAGGCACCGG - Intergenic
1183383414 22:37501863-37501885 ACACTTTCCCAGCCTGACTCAGG + Intronic
1184410026 22:44321035-44321057 GCAGTCTCCCAGGCAGCCCCAGG - Intergenic
1185112099 22:48905803-48905825 CCTCTCTCCGAGGCAGCCACTGG + Intergenic
950111530 3:10421754-10421776 CCACTCTCCTACCAAGCCACGGG + Intronic
950138839 3:10601455-10601477 AGACTCTCACAGCCAGCCTGGGG - Intronic
950188509 3:10960255-10960277 TCACCCTCCCTGCCAGCCTCAGG + Intergenic
953513144 3:43563835-43563857 ACACACACCCACCCAGCCTCTGG - Intronic
955835223 3:63047299-63047321 ACACCCTCCCACCCTCCCACAGG + Intergenic
957021900 3:75137159-75137181 TCACTCGCCCTGCCTGCCACTGG - Intergenic
957906969 3:86569876-86569898 AAACTCTCCAACCAAGCCACTGG + Intergenic
960067000 3:113384804-113384826 ACACTTTCACAGCTACCCACTGG - Intronic
960317996 3:116201469-116201491 GCACTCTGCCAGCCATGCACAGG - Intronic
961312280 3:126010654-126010676 AATCTCACCCTGCCAGCCACAGG - Intronic
963369200 3:144376617-144376639 TCACTGCCTCAGCCAGCCACAGG + Intergenic
970931148 4:21513615-21513637 CCACTCTCACAGCAAACCACTGG - Intronic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
973337056 4:48967308-48967330 AGACTCACCCACACAGCCACAGG - Intergenic
978825994 4:113024300-113024322 ACACTCTCTCAGATAGACACAGG + Intronic
980030214 4:127819650-127819672 GCCCTCTCCCTGCCAGCCACAGG + Intronic
984860125 4:184230439-184230461 CCTCTCTCCCTGCCAGCCCCCGG + Intergenic
984892567 4:184506787-184506809 ACACAATGCCAGGCAGCCACTGG + Intergenic
985249814 4:188012593-188012615 GCACAATCCAAGCCAGCCACAGG + Intergenic
985754085 5:1702774-1702796 ACCCTCCCCCATCCAGCGACTGG + Intergenic
985851454 5:2391726-2391748 CCAGTCTCCCAGCCCGCCCCAGG + Intergenic
986440802 5:7779969-7779991 ATACTTTACCAGCCAGCCACGGG + Intronic
988984986 5:36609099-36609121 GCACTCTCTCACCCAGCAACTGG + Intronic
990192771 5:53278889-53278911 ACACTCTCTCAGCTCCCCACAGG + Intergenic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
990882507 5:60555812-60555834 GGACTCTCCGAGCCAGGCACGGG - Intergenic
995449192 5:112281518-112281540 ACACTCTCCTAGCCAGATGCTGG + Intronic
999904066 5:156119962-156119984 GCACTCTCCCATGCAGACACTGG + Intronic
1000351787 5:160358091-160358113 ACACCCTTCCACCCAGGCACTGG - Intronic
1000412327 5:160946873-160946895 GGACTCTCCAAGCCAGGCACGGG + Intergenic
1001433339 5:171680686-171680708 CCACCTTCCCAGCCAGCCACAGG - Intergenic
1002443147 5:179274659-179274681 AGAGGCTCCCAGCCAGCAACAGG - Intronic
1003115594 6:3281800-3281822 ACATTCTCCCAGCCTGGCCCAGG + Intronic
1004178224 6:13359180-13359202 ACCTTCTCCCCGCCAGGCACAGG - Exonic
1005875248 6:30006428-30006450 TCCCTCTCCCAGCCTGCGACGGG + Intergenic
1007726365 6:43918292-43918314 TGACTCACACAGCCAGCCACTGG - Intergenic
1007746547 6:44046792-44046814 CCACCCTCACAGCCAGCCAAAGG + Intergenic
1007988381 6:46230563-46230585 GCACCCTCCAAGCCAGGCACAGG + Intronic
1009000488 6:57707064-57707086 CCACTCTCCCGTCCACCCACCGG + Intergenic
1010809914 6:80289664-80289686 TCACTCTCACCGCCAGCCTCTGG + Intronic
1011004129 6:82624809-82624831 ACACCTTCCCAGCCAGTAACTGG + Intergenic
1018097126 6:160398619-160398641 ACACTCACCATGCCTGCCACTGG - Intronic
1018648654 6:165972339-165972361 ACACTCTCTCTGCTGGCCACGGG + Intronic
1019261667 7:85259-85281 ACACTCTCCTATACACCCACGGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020280513 7:6647834-6647856 ACACGGTCCCAACCTGCCACGGG - Intronic
1020318434 7:6923611-6923633 TTTCTTTCCCAGCCAGCCACGGG + Intergenic
1020772026 7:12406619-12406641 CCACGCTCCCAGCCACACACAGG - Intergenic
1022109570 7:27220180-27220202 GCTCTCTGCCACCCAGCCACGGG - Intergenic
1022267505 7:28771785-28771807 CCACCCTCCCACCCACCCACGGG - Intronic
1024352533 7:48381490-48381512 AGAGTCTCCCAGTCAGACACCGG - Intronic
1024717213 7:52093045-52093067 ACCCTCTCCCAGACAGCACCTGG - Intergenic
1024776057 7:52787476-52787498 TCCCTATCCCAGCCACCCACAGG - Intergenic
1026627739 7:72011290-72011312 ACCTCCTCCCAGCCAGACACTGG - Intronic
1028336272 7:89660401-89660423 TCACTCTTCCAGCCAGGTACCGG - Intergenic
1030179437 7:106690156-106690178 GCACCCTCCAAGCCAGGCACGGG + Intergenic
1030694235 7:112567657-112567679 AAAGTCCCCCAGCCAGCCAGTGG + Intergenic
1031344732 7:120651402-120651424 GGACTCTCCCAGCCATGCACGGG + Intronic
1031988123 7:128177031-128177053 CCACACACCCAGCCAGCCTCTGG - Intergenic
1032166377 7:129548366-129548388 ACACACTACCACACAGCCACGGG - Intergenic
1032783393 7:135182437-135182459 ACACTGTCCCACGCAGCCAGGGG - Intergenic
1036500627 8:9310807-9310829 TCAATCTCCCAGCCATGCACAGG - Intergenic
1037435103 8:18854260-18854282 ACATTCTCCCAGAATGCCACTGG + Intronic
1038781657 8:30573332-30573354 ACTCCATCCCAGCCAGTCACTGG + Intergenic
1038800404 8:30744087-30744109 ACCCTCTCCCAGCCGGCCCGCGG + Intronic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048621107 8:136133784-136133806 AAACTCTGCCAGTCAGCCTCTGG + Intergenic
1049193989 8:141305672-141305694 AAACCACCCCAGCCAGCCACTGG + Intronic
1049570575 8:143368631-143368653 ACAACCTGCCAGCCAGCCGCGGG + Intergenic
1049906069 9:217365-217387 GAAAGCTCCCAGCCAGCCACTGG - Intronic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1051298189 9:15618739-15618761 TCCCTCCCCCAGCCAGCCAGGGG - Intronic
1053073418 9:35114501-35114523 ACCCTCTCCCAGCCAGCCCAGGG + Intronic
1053177556 9:35939015-35939037 ACACTGGGCCAGACAGCCACAGG - Intergenic
1054912565 9:70467329-70467351 AGACTCACCCACCCAGTCACAGG - Intergenic
1057040785 9:91846031-91846053 ACACTCACACAGGGAGCCACTGG + Intronic
1058398226 9:104581129-104581151 TCACTCTGTCACCCAGCCACGGG + Intergenic
1058795897 9:108498120-108498142 GGACTCTCCGAGCCAGGCACGGG - Intergenic
1060403622 9:123362136-123362158 ACCCACCCCCTGCCAGCCACTGG - Intronic
1061423504 9:130484972-130484994 CCACCCTCCCAGGCAGCCTCCGG - Intronic
1061434314 9:130551356-130551378 AGACTCCCACAGCCGGCCACCGG - Intergenic
1062458694 9:136653783-136653805 ACCCACTCCCTGCCAGCCCCCGG - Intergenic
1062562248 9:137146765-137146787 ACATGCTCCCAGCCACCCATAGG - Intronic
1062574184 9:137198945-137198967 ACTCTCTCCCTGCCAGCCAGTGG + Intronic
1062606625 9:137351386-137351408 GCACTCTCGCAGCCACCAACAGG - Exonic
1062725964 9:138073684-138073706 ACCCTCTCCCAGCCTCCCAAAGG - Intronic
1187419493 X:19122369-19122391 AGACTCGCACAGCCGGCCACGGG - Intronic
1187610214 X:20934778-20934800 ACACTCTCTCTGCCAGCCTTTGG + Intergenic
1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG + Intronic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191828289 X:65389422-65389444 GGACTCTCCAAGCCAGGCACGGG + Intronic
1192557440 X:72101660-72101682 GCTCCCTCCCAGGCAGCCACAGG - Intergenic
1193246597 X:79237226-79237248 ATCTTCTCCCATCCAGCCACAGG - Intergenic
1194184474 X:90756835-90756857 ACATTCTCCATTCCAGCCACAGG - Intergenic
1195163695 X:102196844-102196866 GGACTCTCCGAGCCAGGCACAGG + Intergenic
1198095477 X:133376144-133376166 ACAGGCTCCCAGCTCGCCACTGG + Intronic
1198572263 X:137970664-137970686 ACTCTCTCCCAACCAAACACCGG - Intergenic
1199820588 X:151442036-151442058 ACACCCTCACAGACACCCACAGG - Intergenic