ID: 1048180701

View in Genome Browser
Species Human (GRCh38)
Location 8:132191976-132191998
Sequence ACTTGGACCTCAAGTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048180701_1048180711 29 Left 1048180701 8:132191976-132191998 CCTGCTGCACTTGAGGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1048180711 8:132192028-132192050 AAATTTAAGGCTTAGGGGAAAGG No data
1048180701_1048180708 22 Left 1048180701 8:132191976-132191998 CCTGCTGCACTTGAGGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1048180708 8:132192021-132192043 GAAATCTAAATTTAAGGCTTAGG No data
1048180701_1048180703 -7 Left 1048180701 8:132191976-132191998 CCTGCTGCACTTGAGGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1048180703 8:132191992-132192014 TCCAAGTGGAAATCTCCATCCGG No data
1048180701_1048180709 23 Left 1048180701 8:132191976-132191998 CCTGCTGCACTTGAGGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1048180709 8:132192022-132192044 AAATCTAAATTTAAGGCTTAGGG No data
1048180701_1048180710 24 Left 1048180701 8:132191976-132191998 CCTGCTGCACTTGAGGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1048180710 8:132192023-132192045 AATCTAAATTTAAGGCTTAGGGG No data
1048180701_1048180707 16 Left 1048180701 8:132191976-132191998 CCTGCTGCACTTGAGGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1048180707 8:132192015-132192037 CTGATTGAAATCTAAATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048180701 Original CRISPR ACTTGGACCTCAAGTGCAGC AGG (reversed) Intronic
900520456 1:3102875-3102897 ACTCTGACCTCCAGAGCAGCAGG - Intronic
900540371 1:3199732-3199754 CCTTGGGGCTCGAGTGCAGCTGG - Intronic
901041080 1:6363938-6363960 GCTGGGACCACAGGTGCAGCTGG - Intronic
902184927 1:14717877-14717899 ACTTGGATTTCGGGTGCAGCAGG - Intronic
903183268 1:21615728-21615750 TAGTGGACCTCGAGTGCAGCAGG - Intronic
907451011 1:54545900-54545922 ACTTGGACACCATGTGCAGGAGG - Intronic
907492218 1:54815471-54815493 TCTTGGGCCTCAGGGGCAGCTGG + Intronic
907937334 1:59054339-59054361 AGCTGGACCTCAGGTGCTGCTGG - Intergenic
908586700 1:65577736-65577758 ACTTGGACCTTGAGTGAATCAGG + Intronic
911542601 1:99176021-99176043 GCTTGCATCTCAAGTGTAGCTGG + Intergenic
911647757 1:100353473-100353495 ACTTGCACCTCCAGTTCTGCGGG + Intronic
916957994 1:169860208-169860230 AGATGGAAATCAAGTGCAGCTGG - Intronic
917493409 1:175517900-175517922 ACTAGGATCTCCAGTGCTGCTGG - Intronic
918750525 1:188263823-188263845 ACTTGACCCAGAAGTGCAGCTGG + Intergenic
919881371 1:201903360-201903382 AGTGGGGCCTCCAGTGCAGCTGG - Intronic
920371084 1:205479746-205479768 TCAAGGACCTCTAGTGCAGCAGG + Intergenic
921269781 1:213457232-213457254 ACTTGGAGCTCAGCTCCAGCAGG - Intergenic
923090965 1:230740994-230741016 ACTTGAATCACAGGTGCAGCAGG - Intergenic
924028890 1:239867047-239867069 GCTTGGCTCTGAAGTGCAGCTGG - Intronic
1065859415 10:29859080-29859102 ACTTGGAGCTCAAGAGCTGGAGG - Intergenic
1066291205 10:34015997-34016019 GCTTGGAGCTCCATTGCAGCAGG + Intergenic
1068459332 10:57306734-57306756 ACTTATACCTGAAGTGGAGCAGG - Intergenic
1074429802 10:113384796-113384818 ACTTGGAGCTGAAGTCCTGCTGG - Intergenic
1075498741 10:122953402-122953424 GCTTGGACCTCAAGGGCAAGTGG - Intronic
1085741367 11:79080665-79080687 ACTGGGGCCCCAAGTACAGCTGG + Intronic
1088095792 11:106099982-106100004 ATTTGGTCCTCAAGTTCAGATGG - Intergenic
1105925473 13:25003796-25003818 ACTGAGATCTCATGTGCAGCGGG + Intergenic
1106039226 13:26073851-26073873 ACTGAGATCTCATGTGCAGCGGG - Intergenic
1106067572 13:26370281-26370303 ACTTAGACCTTAAGTTCACCCGG - Intronic
1106314122 13:28578575-28578597 ACTTAGAAGTCCAGTGCAGCTGG + Intergenic
1114511764 14:23268137-23268159 ACTTGGAGCTCAAGTTCACCAGG - Intronic
1114530355 14:23391583-23391605 CCATGGGCCTCAAGTGCAGAGGG + Intronic
1124004059 15:25782528-25782550 AATGGGACTTAAAGTGCAGCAGG + Intronic
1126811910 15:52415141-52415163 ACTTGTACCACAGGTGCACCAGG + Intronic
1129092668 15:73167503-73167525 ACATGGACCTCAGATGGAGCAGG - Intronic
1131003972 15:88960783-88960805 ACTCTGACTCCAAGTGCAGCAGG - Intergenic
1132674284 16:1115220-1115242 CCTTGGAGCTCTAGTGCATCTGG + Intergenic
1139666842 16:68463350-68463372 ACTGGAACCTCAAGTGAAGCTGG + Intergenic
1140314226 16:73879076-73879098 ACTTGGTCCTCAAGAGAAGTTGG - Intergenic
1141276849 16:82596127-82596149 ACTTCGAACTGAAGTCCAGCTGG + Intergenic
1141736025 16:85853962-85853984 ATTTGGAAGTCAAATGCAGCAGG + Intergenic
1143251023 17:5523055-5523077 ACTGGGACCTCAAGTCTAGAGGG + Intronic
1147285891 17:39402178-39402200 CCTTGAACCCAAAGTGCAGCAGG + Intronic
1147450153 17:40499464-40499486 ACATGGAATTCAAGTGCAGAGGG + Intronic
1152583376 17:81178754-81178776 CCTCGGGCCTCCAGTGCAGCGGG - Intergenic
1152692682 17:81727281-81727303 CCTTGGGCCTCAAGGGCACCAGG + Intergenic
1160725952 19:617930-617952 CCCTGGACCTCAAGTGGAGGGGG - Intronic
1163781695 19:19253368-19253390 ACTTTGACCTTAGGTGCAGGCGG - Intergenic
1163830607 19:19545514-19545536 GCGTGGAGTTCAAGTGCAGCGGG + Exonic
927319927 2:21731450-21731472 CCTTGGACCCTAAGTGCTGCAGG - Intergenic
927459657 2:23287074-23287096 ACTTGGATATCTAATGCAGCTGG + Intergenic
927692948 2:25221271-25221293 ACTTGGACTACAGCTGCAGCAGG + Intergenic
931705780 2:64945051-64945073 TCCTGGCCCTCAAGAGCAGCGGG + Intergenic
938762268 2:134436614-134436636 CCTTGCACCTCAGGTCCAGCAGG - Intronic
940384247 2:153051779-153051801 ACTTGGTCTTAAACTGCAGCAGG - Intergenic
940854883 2:158722317-158722339 ATTTGGGCCTCAGGGGCAGCAGG + Intergenic
948220496 2:236265709-236265731 CCTGGCACCTCAAGTGCAGATGG - Intergenic
948817662 2:240521067-240521089 ACTTGGGCCTCAAGAGAGGCTGG + Intronic
1169895536 20:10501610-10501632 ACTTGGTTCTCGAGGGCAGCAGG + Intronic
1172814349 20:37674365-37674387 CCTCTGACCTCAACTGCAGCTGG - Intergenic
1174475485 20:50793211-50793233 ACTTGGGCCTCAAGTGCTTAAGG - Intergenic
1176234531 20:64048316-64048338 ACCAGTACCTCAACTGCAGCCGG - Exonic
1176654752 21:9578323-9578345 ACTTGGAGCTAATGTTCAGCTGG - Intergenic
1176717613 21:10366543-10366565 ACCTCGAACTCAAGTGTAGCTGG - Intergenic
1177133860 21:17290059-17290081 CCTTGCCCCTCCAGTGCAGCAGG + Intergenic
1180298840 22:11019463-11019485 ACCTCGAACTCAAGTGTAGCTGG - Intergenic
1185157684 22:49204160-49204182 GGCTGGACCTCAGGTGCAGCTGG + Intergenic
1185389658 22:50552261-50552283 ACCTGGACAGCAGGTGCAGCAGG + Intronic
1185401741 22:50622464-50622486 ACTCGGACCACAAGTGCACAAGG + Intergenic
950142335 3:10623941-10623963 ACTCGGGCCCCAAGAGCAGCTGG - Intronic
950423835 3:12914251-12914273 CATTGGGCCTCAAGGGCAGCTGG - Intronic
950463570 3:13140012-13140034 AGTTGGAGCTCAGGAGCAGCTGG - Intergenic
952813314 3:37424498-37424520 ACTTCCACCTCCTGTGCAGCTGG + Intronic
953735915 3:45493912-45493934 ACTTGGACCTCACTTGCACAAGG + Intronic
954255417 3:49401983-49402005 ACTTGGAGATCAAGAGCAGCAGG + Intronic
958803815 3:98785675-98785697 ACTTGGATTTTAAGTGCAACAGG + Intronic
961057469 3:123801235-123801257 ACTTGGACCTCAAGGGACCCTGG + Intronic
961576530 3:127841459-127841481 TCTTGGACTTCAGGTGCAGAGGG - Intergenic
964727133 3:159825298-159825320 ATTTTGCCCTCAAGTGCAGCTGG + Intronic
965384272 3:168027097-168027119 ACTGAGACCTCTAGTTCAGCTGG - Intronic
966351418 3:179036073-179036095 ACTTGGACTTCAGAGGCAGCAGG + Intronic
966493317 3:180552470-180552492 ACGTGGACCTGAAGTTGAGCTGG + Intergenic
966496778 3:180590337-180590359 ACTGGGACCACAGGTGCACCTGG - Intergenic
968533002 4:1105114-1105136 ACTTGGAACTCAAAAGCAACTGG + Intronic
974240537 4:59240033-59240055 ACTTTGACCAGAGGTGCAGCAGG + Intergenic
979174987 4:117651917-117651939 GCTTGGACCCCCAGTGCAGCTGG - Intergenic
981559693 4:146033378-146033400 ACTGTGACCTCAACAGCAGCCGG - Intergenic
981892592 4:149755767-149755789 ACTTCAACTTCAAGTGCACCTGG - Intergenic
984304588 4:177972139-177972161 TCATGGTCCTCAAGTGAAGCAGG - Intronic
985236594 4:187881985-187882007 AAATGGACCTCAAGTGTAGATGG - Intergenic
985625310 5:982517-982539 GCCTGGACCTCACTTGCAGCTGG - Intergenic
986129352 5:4912532-4912554 GCCTGGGCCTCAGGTGCAGCCGG + Intergenic
989637742 5:43555101-43555123 ACTTGGACATCAAGAACAACTGG + Intronic
1000287936 5:159844113-159844135 ACTTGGAACACAAGTTCTGCAGG - Intergenic
1003610204 6:7606743-7606765 ACCTGGATCTCAAGTTCATCAGG + Intronic
1005209266 6:23441906-23441928 GCTTGGACCTTAAGTTCAGGAGG + Intergenic
1005792179 6:29314723-29314745 GGTTGGATCTCAAGTGCAGAAGG + Intergenic
1009929981 6:70165633-70165655 TCCTGGACTTCCAGTGCAGCTGG - Intronic
1011384077 6:86775296-86775318 ACTTGCCCCTCAAGAGAAGCTGG - Intergenic
1013798688 6:113914800-113914822 ACTTGGATCTCAAGTAGGGCTGG - Intergenic
1014415933 6:121184630-121184652 ACTTGGACCTTTACTCCAGCAGG + Intronic
1018722191 6:166581469-166581491 ACTTGGACATCAAGTCCCTCAGG - Intronic
1023603317 7:41902489-41902511 CCATGGACCTCAAGTGCACCTGG + Intergenic
1024027020 7:45419828-45419850 AATGGGACCTCAAGTCCAGCAGG + Intergenic
1030311078 7:108069765-108069787 AATGGGACCTCAAGTGCTCCCGG - Exonic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035748672 8:1979777-1979799 ACGCGGTCCTGAAGTGCAGCTGG + Intronic
1036662716 8:10718173-10718195 ACATGGACCTGGACTGCAGCAGG + Intergenic
1037225015 8:16576197-16576219 ACTTGAACATCAGATGCAGCAGG - Intergenic
1041469538 8:58193365-58193387 TCTGGGACCTCAACTCCAGCTGG - Intronic
1046952604 8:120032551-120032573 AGTGGGACCACAAGTGAAGCTGG + Intronic
1048180701 8:132191976-132191998 ACTTGGACCTCAAGTGCAGCAGG - Intronic
1049321168 8:141997214-141997236 ACCTGGACCTCAACTGCACAGGG + Intergenic
1056822037 9:89849704-89849726 ACTGGGAGCTGAAGGGCAGCAGG - Intergenic
1185482233 X:455468-455490 CCTGGGAACTCAAGGGCAGCAGG - Intergenic
1189164280 X:38844966-38844988 AATTGGACCTTCAGTGCTGCTGG - Intergenic
1193532361 X:82671186-82671208 ACTTTGATCTAAAGTCCAGCAGG - Intergenic
1195220281 X:102739739-102739761 AATTGGAACTCCAGTGCTGCCGG - Intronic
1195285100 X:103376435-103376457 ACTTGGGCGGCCAGTGCAGCAGG - Exonic
1199274274 X:145923518-145923540 ACATGGACCTAAAGTTGAGCTGG + Intergenic
1200043814 X:153388903-153388925 ATTTGGACCTCAAGTCTAGACGG + Intergenic