ID: 1048182058

View in Genome Browser
Species Human (GRCh38)
Location 8:132204476-132204498
Sequence ATGGGGGACCAGAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048182058_1048182071 14 Left 1048182058 8:132204476-132204498 CCAGCCTCATTCTGGTCCCCCAT 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1048182071 8:132204513-132204535 CTGGCCTTGGCTGGGCATCAGGG No data
1048182058_1048182063 -5 Left 1048182058 8:132204476-132204498 CCAGCCTCATTCTGGTCCCCCAT 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1048182063 8:132204494-132204516 CCCATTCTCTGCCTAACTCCTGG No data
1048182058_1048182065 1 Left 1048182058 8:132204476-132204498 CCAGCCTCATTCTGGTCCCCCAT 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1048182065 8:132204500-132204522 CTCTGCCTAACTCCTGGCCTTGG No data
1048182058_1048182070 13 Left 1048182058 8:132204476-132204498 CCAGCCTCATTCTGGTCCCCCAT 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1048182070 8:132204512-132204534 CCTGGCCTTGGCTGGGCATCAGG No data
1048182058_1048182068 6 Left 1048182058 8:132204476-132204498 CCAGCCTCATTCTGGTCCCCCAT 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1048182068 8:132204505-132204527 CCTAACTCCTGGCCTTGGCTGGG No data
1048182058_1048182066 5 Left 1048182058 8:132204476-132204498 CCAGCCTCATTCTGGTCCCCCAT 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1048182066 8:132204504-132204526 GCCTAACTCCTGGCCTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048182058 Original CRISPR ATGGGGGACCAGAATGAGGC TGG (reversed) Intronic
901451089 1:9337499-9337521 ATGGGAGAACAGGGTGAGGCTGG + Intronic
904682708 1:32240367-32240389 GGGCGGGACCAGAATGGGGCAGG + Intergenic
905323600 1:37134477-37134499 ATGGGAGGCCAGGATCAGGCAGG + Intergenic
905346561 1:37315106-37315128 CTTGGGGACTGGAATGAGGCAGG - Intergenic
906120120 1:43384084-43384106 ATGGTGGACCAGAATGATGGTGG - Exonic
908072923 1:60483310-60483332 ATGGGGGCCCAGGATGGGGGAGG + Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
909474393 1:76065672-76065694 ATGTGGGACCAGAAAGAGGCGGG + Intergenic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
910259750 1:85283823-85283845 CTTGGGGGCCAGAATCAGGCAGG + Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911176986 1:94826945-94826967 AGGGGGGACAAGAATGAAACTGG - Intronic
912501550 1:110125863-110125885 ATTGAGGACCTGAATGAGTCAGG + Intergenic
912715599 1:111981642-111981664 ATGGTGTACCAAAACGAGGCAGG + Exonic
913484466 1:119321167-119321189 ATAGGGGAGCAGAAAGAGACTGG - Intergenic
920184158 1:204150312-204150334 ATCATGGACCAGAATGTGGCAGG + Intronic
920855047 1:209655183-209655205 ATGGGGGACAGGGATGGGGCAGG - Intergenic
921600243 1:217098974-217098996 ATGGGGGAAAAGAATAAAGCAGG - Intronic
922276010 1:224079054-224079076 TTTGGGGATCAGAATGAGACAGG - Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067079871 10:43206798-43206820 GTGGCTGACCAGTATGAGGCAGG + Intronic
1067203376 10:44193989-44194011 CTGGGGGGCCACAAGGAGGCAGG + Intergenic
1068004741 10:51380021-51380043 ATGGTGGAGAAGAATGAGCCAGG - Intronic
1069755427 10:70771858-70771880 ATGGGGGACAAGAATGGGTGAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1073512428 10:104051187-104051209 ATAGGGGACAAGAGAGAGGCAGG + Intronic
1074449170 10:113545257-113545279 ATGAGGGCACAAAATGAGGCTGG + Intergenic
1076080444 10:127575793-127575815 ATGTGGTACCAGAATGATTCAGG - Intergenic
1077074462 11:694181-694203 AGGGGGGACCAGTAGGAGGCGGG + Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1080484479 11:32691067-32691089 CTGGGGGACAAGAGTGAGACTGG - Intronic
1080767335 11:35309092-35309114 ATAGGGGATCAGAATGAGTTAGG - Intronic
1082791566 11:57349583-57349605 ATGGGGCACCAGAAAGATGCAGG + Intronic
1084767972 11:71324838-71324860 GTGGGGAGCAAGAATGAGGCAGG + Intergenic
1085041383 11:73328403-73328425 ATGGGGGCCCAGAGAGGGGCAGG + Intronic
1085522757 11:77147882-77147904 CTGGGGGACCTCAACGAGGCGGG + Exonic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1087626872 11:100605291-100605313 TTGGGGTACCAGAAAGAGACAGG + Intergenic
1088689265 11:112311411-112311433 GTGAGGGAGCAGAATGAGCCAGG + Intergenic
1088696468 11:112370392-112370414 CTGGGGGTCCAGCCTGAGGCTGG + Intergenic
1090366586 11:126211678-126211700 AAGGGCGACTACAATGAGGCGGG + Exonic
1090470952 11:126980681-126980703 ATGGGAGATGAGAAAGAGGCTGG + Intronic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1095468138 12:42509472-42509494 AAGGGTGAGCAGAATAAGGCAGG - Intronic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1096747380 12:53737797-53737819 AGAGGGGACAGGAATGAGGCTGG - Intergenic
1096900718 12:54878131-54878153 ATGAGGGATCAGCATGGGGCTGG + Intergenic
1096990401 12:55797081-55797103 ATGAGGGACCTTAATGAGACTGG - Intronic
1099145407 12:79037328-79037350 AGGGGGGATGACAATGAGGCAGG - Intronic
1101545397 12:105707448-105707470 ATGGGCGCACAGAATCAGGCAGG + Intergenic
1101853806 12:108425613-108425635 ATGTGGGATCAGGCTGAGGCTGG - Intergenic
1102070187 12:110012488-110012510 ATGGGAGCCCAGGATGATGCAGG + Intronic
1107508355 13:41058309-41058331 AGGGGGAACAAGTATGAGGCTGG - Intronic
1107869115 13:44730752-44730774 ATGGGTGACCACTATGTGGCTGG + Intergenic
1108722039 13:53142080-53142102 ATGGGGGATGTGACTGAGGCTGG - Intergenic
1110879590 13:80555382-80555404 AAGGGGGCTCAGAATGGGGCAGG - Intergenic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1121654959 14:95588406-95588428 AGGGGAGACCAGGATGAGGAGGG + Intergenic
1202871950 14_GL000225v1_random:173003-173025 GGGGGGGAGCAGAAAGAGGCTGG + Intergenic
1125549538 15:40535046-40535068 CTGGGGGACCAGACTGTGGAGGG + Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1129255429 15:74331453-74331475 ATGGGGCGCCTGAATGAGGAGGG - Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131637160 15:94248162-94248184 ATGTGGGACCTGAAAGAGCCAGG + Intronic
1132038218 15:98503856-98503878 ATGGGGGAGCAAAAAGGGGCAGG - Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132640541 16:976278-976300 ATGAGGGCCCAGAACGAGGCTGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133136650 16:3717181-3717203 ATGGGAGCCCTGAAGGAGGCTGG - Intronic
1133395372 16:5442806-5442828 ATGGGGGACATGAATTTGGCAGG - Intergenic
1134329314 16:13235859-13235881 ATGGGGGTAGAGAATGAGGGAGG + Exonic
1137018390 16:35397988-35398010 ATGTGGAATCAGAATGAAGCAGG - Intergenic
1137392689 16:48094491-48094513 AAGGGGGCCCACAAAGAGGCTGG + Intronic
1138394715 16:56695310-56695332 TTGGGGGGCCAGAAGCAGGCAGG + Intronic
1139194960 16:64907808-64907830 ATGGAAGACCAGAAAGATGCAGG - Intergenic
1141858578 16:86701327-86701349 ATCAGGGAACAGAATGGGGCGGG - Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142399394 16:89851435-89851457 AAGGGGCAGGAGAATGAGGCTGG - Intronic
1143875100 17:9985456-9985478 ATGGGGGAGCAGGAGGCGGCAGG - Intronic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1145902739 17:28498818-28498840 CTGGGGGACCAGGGTGGGGCTGG - Intronic
1145963089 17:28898644-28898666 ATGGGAGGCCAGCAAGAGGCTGG - Exonic
1147816932 17:43217028-43217050 ATGGGGGTCCAGCATGTGCCTGG + Intronic
1148866323 17:50630656-50630678 ATGGGGCACCAGGCTGTGGCAGG - Intergenic
1148872257 17:50665465-50665487 ATGGCAGTCCAGAATCAGGCAGG + Intronic
1149034089 17:52115339-52115361 ATGGGCCACCAAAATGATGCAGG - Intronic
1149517508 17:57291889-57291911 ATGGCGGGGGAGAATGAGGCTGG - Intronic
1150292266 17:63988613-63988635 CTGGGGGACCAGAAGGGGTCTGG - Intergenic
1151319448 17:73343687-73343709 AGGGAGGGCCAGAAGGAGGCAGG + Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1156513201 18:37659001-37659023 ATGGTGGACCAGACAGTGGCAGG - Intergenic
1160955251 19:1688313-1688335 CTGTGGGACCAGAATGGGGTGGG + Intergenic
1161471038 19:4456976-4456998 ATGGGAGACTAGAAAGAGTCTGG - Intronic
1165087826 19:33363641-33363663 ATGGCATATCAGAATGAGGCGGG + Intergenic
1165283765 19:34820125-34820147 ATAGGGGACCAGGATGAAGTTGG + Intergenic
1165854259 19:38870354-38870376 ACGGGGGACCAGAGCTAGGCAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167106957 19:47436024-47436046 AAGAGGTACCAGGATGAGGCTGG - Intronic
1167428131 19:49440118-49440140 ATGAGAGACAAGAATAAGGCTGG - Intronic
1167510797 19:49894564-49894586 GCTGGGGACCAGCATGAGGCTGG + Intronic
1167516878 19:49928846-49928868 CTGCGGGAAGAGAATGAGGCTGG + Exonic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1168266050 19:55224652-55224674 TCGGGGGACCAGAATCAGGGAGG + Intergenic
925068767 2:950617-950639 ATGGGGGACCATAGCGGGGCTGG - Intergenic
926383994 2:12317892-12317914 GTGTGGGAGTAGAATGAGGCTGG + Intergenic
926792080 2:16584305-16584327 ATGAGGGAACAGAGTGAAGCGGG - Intronic
926926731 2:17995207-17995229 ATGGGCCACCAAAATGATGCAGG - Intronic
932398262 2:71462907-71462929 ATGGGTGACCAGGAGCAGGCTGG + Intronic
933036259 2:77402742-77402764 ATGGGGGATCTGAATCAAGCAGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934014478 2:87864461-87864483 CTGGGGGACCAGAAAGAGAGTGG - Intergenic
934602777 2:95670802-95670824 ATGGGGGATCAGGGTGAAGCAGG + Intergenic
935157710 2:100497733-100497755 AGTGGGTACCAGAATGAAGCGGG - Intergenic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935679630 2:105624753-105624775 ATAAGGGACAAGAAGGAGGCAGG - Intergenic
936117292 2:109712273-109712295 ATGAGTGACCAGAGTCAGGCAGG - Intergenic
936536159 2:113312995-113313017 ATGGGGGATCAGGGTGAAGCAGG + Intergenic
936656721 2:114496742-114496764 ATGAGGGGTCACAATGAGGCTGG + Intronic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
937973120 2:127565317-127565339 CTGGGGGACCTGAACGAGGCAGG + Exonic
939551408 2:143620095-143620117 ATATGTCACCAGAATGAGGCAGG - Intronic
942164661 2:173230468-173230490 TTGGGAGGCCAGAATAAGGCTGG - Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944666137 2:201961240-201961262 ATGGGGGAACAGGCAGAGGCGGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946245093 2:218382907-218382929 CTGGGCCACCAGAAAGAGGCAGG + Intronic
946640022 2:221773983-221774005 ATGGAGGACCAGAAACAGGTAGG - Intergenic
947533010 2:230924676-230924698 ACTGGGGACCAGAAGGAGCCTGG - Intronic
948787045 2:240358242-240358264 ATGGGGAACCAGCATGGGGCTGG + Intergenic
949005489 2:241644480-241644502 ATGGGTGAGGAGACTGAGGCTGG + Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172635514 20:36407245-36407267 ATGGGGGAACCGCTTGAGGCTGG + Intronic
1172638036 20:36423065-36423087 ATGGGGGGCTTGAATGAGGACGG - Intronic
1172698709 20:36839533-36839555 GTGGGGGACCTGGATGTGGCAGG + Intronic
1173764431 20:45594643-45594665 ATGGGGTACCTGAAAGAGACTGG - Intergenic
1176515711 21:7781846-7781868 ATGGGTGACCAGAGAGAGCCAGG - Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178649739 21:34411858-34411880 ATGGGTGACCAGAGAGAGCCAGG - Intergenic
1179045684 21:37843187-37843209 AATGGGGTCCAGAATGTGGCAGG - Intronic
1179887572 21:44320914-44320936 AGGGAGGACCAGACTCAGGCTGG - Intronic
1179956228 21:44740694-44740716 ATGGGCCACCAAAATGATGCAGG - Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1181397610 22:22633062-22633084 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181500358 22:23312432-23312454 CTGGGGGCCCAGAATGAACCTGG + Intronic
1181651796 22:24262996-24263018 CTGGGGGCCCAGAATGAACCTGG - Intergenic
1181705580 22:24647743-24647765 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1183687208 22:39368025-39368047 ATTGGAGACAAGAATGAGCCAGG - Intronic
1184485453 22:44775971-44775993 ATGAGTGACCAGAATCAGGAAGG - Intronic
1184811021 22:46832099-46832121 GTGGGGGCCCAGCAAGAGGCTGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185071494 22:48659168-48659190 ACGAGGGCCCAGAGTGAGGCAGG - Intronic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
949944215 3:9177446-9177468 CTGGGGGACCTGGAGGAGGCAGG + Intronic
950578233 3:13845989-13846011 ATGGGGGTTCAGGATGAGACTGG - Intronic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
953648087 3:44773762-44773784 ATGGGCCACCAAAATGATGCAGG + Intronic
953677652 3:45015857-45015879 ATGGGAGTCCAGAATAAGACAGG + Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
959129810 3:102340459-102340481 ATGCTGGCCCAGACTGAGGCTGG + Intronic
961603675 3:128078191-128078213 ATGGGGGTACAGAAGGGGGCTGG - Intronic
962074709 3:132069596-132069618 ATGGGGGACCAGAAGGTTGAAGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
968424728 4:515452-515474 AGGGGAGCGCAGAATGAGGCAGG - Intronic
969268871 4:6085377-6085399 GTGGGGGACCAGCCTGAGGCTGG + Intronic
969490768 4:7498112-7498134 CTGGGGGGCCAGGATGAGTCTGG + Intronic
969573259 4:8022494-8022516 CTGGGGGGCCAGAATGAGGTGGG - Intronic
970661211 4:18287864-18287886 ATGTGGGAACCGAATAAGGCTGG + Intergenic
971825880 4:31621998-31622020 ATGGGGGAGCAGAATGCTGGTGG - Intergenic
973850575 4:54957672-54957694 CTGGTAGGCCAGAATGAGGCAGG - Intergenic
977703396 4:100046012-100046034 ATTTGGTACCAGAATGATGCTGG + Intergenic
978327418 4:107575166-107575188 ATGGGGGACCAGAAGGTGTGTGG - Intergenic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985520026 5:370043-370065 ATGGGGCACCAGCAAGAGCCCGG - Intronic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
991770273 5:70034521-70034543 TTGGGAGACGAGACTGAGGCAGG - Intronic
991849568 5:70909940-70909962 TTGGGAGACGAGACTGAGGCAGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
995953427 5:117744779-117744801 ATGCGAGACAAAAATGAGGCAGG + Intergenic
996803399 5:127428104-127428126 ATCTGGGTCCAGACTGAGGCAGG + Intronic
998404034 5:141863536-141863558 GTGGAGGACGAGGATGAGGCCGG - Exonic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1001274232 5:170338772-170338794 ATGGGGGAGCAGGTTGAGGGTGG + Intergenic
1002165121 5:177339216-177339238 GTGGGTGACCAGAAAGGGGCTGG - Intronic
1004489183 6:16097998-16098020 ATGGTGGACCAGAATGTGCAAGG - Intergenic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1006834766 6:36991195-36991217 AAGGAAGACCAGAGTGAGGCTGG - Intergenic
1008517778 6:52334466-52334488 GTGGGGGTCCAGTAGGAGGCTGG - Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010991405 6:82484541-82484563 ATGGGCCACCAAAATGATGCAGG - Intergenic
1013470622 6:110460796-110460818 ATGGGGGACCAGCAGGACCCTGG + Intronic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017070201 6:150569364-150569386 ATGAGGTGCCAGAATGAGGCTGG + Intergenic
1017559977 6:155616105-155616127 ATGGGCTACCACAATGATGCAGG + Intergenic
1017831732 6:158136705-158136727 CTTGGGGACCACTATGAGGCAGG + Intronic
1018237276 6:161738738-161738760 GTGGGGGTCCAGCATCAGGCTGG + Intronic
1018463230 6:164018784-164018806 ATGGAGGACCTCCATGAGGCTGG - Intergenic
1021902152 7:25296762-25296784 AGGTGGGACAAGAAGGAGGCAGG - Intergenic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023811419 7:43915249-43915271 ATGGGCCACCAAAATGATGCAGG - Intronic
1026012845 7:66650262-66650284 GTGGGTGACCAAAATGAGGAAGG + Intronic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1028085379 7:86630160-86630182 AAGGCGGAACAAAATGAGGCAGG - Intergenic
1028523155 7:91753968-91753990 TTGGGGTACCTGAAAGAGGCAGG + Intronic
1029304680 7:99610283-99610305 ATTGGGGGGCAGAATGAGGGAGG + Intergenic
1029799007 7:102926012-102926034 ATGGGGGACCAGAAAGAAGCAGG + Intronic
1030090279 7:105852147-105852169 ATGGGGGACTAGAGAGAGGCAGG - Intronic
1030513460 7:110514082-110514104 ATTTGGTATCAGAATGAGGCTGG + Intergenic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033710318 7:143936012-143936034 CTGAGGGACCAGAGTGGGGCTGG - Exonic
1034443661 7:151101004-151101026 ATGGGGGACCTGAAGGTGGTTGG - Intronic
1034645667 7:152644324-152644346 AAGAGGGGGCAGAATGAGGCAGG - Intergenic
1035644063 8:1205054-1205076 ATGGGGAACCGGAATGTGGTTGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036671374 8:10790710-10790732 AGGAGGGGCCAGACTGAGGCAGG - Intronic
1038415557 8:27392539-27392561 ATAGGGGAGGAAAATGAGGCTGG + Intronic
1038581385 8:28752007-28752029 ATGGGGCTCCAGACAGAGGCGGG - Exonic
1038795810 8:30708294-30708316 ATGGGGCAGCAGAATGACACAGG - Intronic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1046259933 8:111754675-111754697 ATGAGTGACAGGAATGAGGCTGG - Intergenic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048315035 8:133355551-133355573 ATTGGGGATCTGAAGGAGGCAGG + Intergenic
1049325298 8:142018359-142018381 ATGGGGCTCCTGCATGAGGCAGG - Intergenic
1049410698 8:142472700-142472722 ATGGGGGATCAGTCTGTGGCTGG + Intronic
1049822647 8:144645512-144645534 AGGAGAGACCAGAGTGAGGCGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1056156994 9:83847683-83847705 ATGGCGCACCAGATTGAGGTTGG - Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG + Intergenic
1059343921 9:113615646-113615668 ATGGGGGACCAGAATCAGAAAGG + Intergenic
1059356307 9:113702023-113702045 ATGGGGGACCAGGATTCCGCTGG + Intergenic
1060547448 9:124469561-124469583 ATGGGGGGCCAGCAGGAAGCAGG + Intronic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1062584071 9:137241205-137241227 ATGGGCTGCCAGAACGAGGCTGG - Exonic
1203732497 Un_GL000216v2:103597-103619 ACGGGGGGGCAGAAAGAGGCTGG - Intergenic
1186673668 X:11793482-11793504 TTGGGGGACAAGAGGGAGGCAGG - Intergenic
1188134199 X:26474229-26474251 AAGAGGGACCAGTATGAGGAGGG + Intergenic
1189443151 X:41055809-41055831 ATGGGGGAAGGGAATGAGGTAGG + Intergenic
1191626068 X:63273024-63273046 ATGGGCCACCAGAATGTTGCCGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192140553 X:68644264-68644286 ATGGGGGATCTGAATCAGGCAGG - Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1193967961 X:88012240-88012262 ATGGGCTACCAAAATGAGTCTGG + Intergenic
1194360146 X:92940391-92940413 CTGTGGGATCAGACTGAGGCTGG + Intergenic
1194482622 X:94445606-94445628 ATGGGGGACTTGAATAATGCAGG + Intergenic
1194940482 X:100003598-100003620 AGGGAGGACCATAATGAGGATGG - Intergenic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1199129999 X:144174011-144174033 CTGGGGGACCAGAAAGAGAGTGG + Intergenic
1199613904 X:149640110-149640132 ACATGGGAGCAGAATGAGGCTGG - Intergenic
1199713783 X:150491579-150491601 ATGGAGGACCACAAAGAAGCAGG + Intronic
1200036323 X:153334084-153334106 ATCGGGGACGAGACTGGGGCCGG + Intergenic
1200668349 Y:6056213-6056235 CTGTGGGATCAGACTGAGGCTGG + Intergenic