ID: 1048182937

View in Genome Browser
Species Human (GRCh38)
Location 8:132213088-132213110
Sequence CACCATTGATAAATGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048182937_1048182940 10 Left 1048182937 8:132213088-132213110 CCATGGATCATTTATCAATGGTG 0: 1
1: 0
2: 1
3: 2
4: 127
Right 1048182940 8:132213121-132213143 TTCTTCCTGGACCTAAGCACAGG No data
1048182937_1048182939 -3 Left 1048182937 8:132213088-132213110 CCATGGATCATTTATCAATGGTG 0: 1
1: 0
2: 1
3: 2
4: 127
Right 1048182939 8:132213108-132213130 GTGTCTAATGGACTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048182937 Original CRISPR CACCATTGATAAATGATCCA TGG (reversed) Intronic
900871025 1:5303177-5303199 CCCCATCGTTAAATGATGCATGG - Intergenic
900914496 1:5625888-5625910 CAGCATCAATAAATGATCAATGG + Intergenic
905371769 1:37486302-37486324 CACTATTGGGAAATGATCCTGGG + Intergenic
907995894 1:59632252-59632274 AGCCATTGATAAATGCTCTAAGG + Intronic
910493317 1:87797253-87797275 TACTACTGATAAATGTTCCAAGG + Intergenic
911152582 1:94609520-94609542 CCACATTTATAAATGAGCCAGGG - Intergenic
917907400 1:179600547-179600569 CCCCATTGTTAAAAGATGCATGG + Intronic
918346596 1:183612974-183612996 GACCAAAGATAAATAATCCATGG + Intergenic
921728453 1:218550528-218550550 CACCAGTGATGAATGAAGCATGG + Intergenic
923939508 1:238805463-238805485 CAATATTGATAAATGTTTCATGG - Intergenic
924801996 1:247334510-247334532 GACCATAGAAGAATGATCCAAGG + Intergenic
1063283451 10:4657325-4657347 CCCCATTGTTAAACGATGCATGG - Intergenic
1063750323 10:8936730-8936752 CACCATTCAAAAATGACCAAAGG - Intergenic
1069192762 10:65510203-65510225 CCCCATTGTTAAGTGATGCATGG + Intergenic
1070418518 10:76212928-76212950 CACCATTGCTGACTGTTCCAAGG + Intronic
1074954308 10:118372663-118372685 CTTCATTGATAAATGATGCTGGG - Intergenic
1075866408 10:125724605-125724627 CCCCATTGTTAAATGACACATGG + Intronic
1076564593 10:131389453-131389475 CACCATTTCTAATTGATCCCAGG - Intergenic
1076901708 10:133342207-133342229 CACCATTTGTAAATCATCTATGG + Intronic
1077762708 11:5120942-5120964 CACCAACAATAAATGCTCCAAGG + Intergenic
1077803243 11:5563079-5563101 CACCATAGCTAAGTGATCCCTGG - Intronic
1079800947 11:24867934-24867956 CACCTTTAAAAAATCATCCAAGG - Intronic
1088026024 11:105184429-105184451 GACCATTTATGAATGATGCATGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090951626 11:131478569-131478591 CACCATTGCTAAATGAATGAAGG + Intronic
1093099914 12:15015337-15015359 AACCATGGTTAAATGATACAAGG + Intergenic
1093745243 12:22733165-22733187 CACCAGTGTTAAATGCTGCATGG + Intergenic
1093931232 12:24956710-24956732 CACCATAGAAAAAAGAACCAGGG - Intergenic
1100698961 12:97125718-97125740 AACCATGGGTAAATGATGCAAGG - Intergenic
1111181625 13:84675431-84675453 CACCATTCAAAAATGTTCTATGG + Intergenic
1112147288 13:96714315-96714337 CACAATTGAAAAATGGGCCAAGG + Intronic
1113408436 13:110062995-110063017 CACTATTAATAATTGATTCAGGG + Intergenic
1116829336 14:49702196-49702218 CCCCATTGAAAAATGAGCAATGG + Intronic
1117007217 14:51433323-51433345 CTCCATGTATAAATGAACCATGG - Intergenic
1117999415 14:61509332-61509354 GACCATTGTTAAGTCATCCATGG + Intronic
1118534805 14:66749666-66749688 CTCTATTGAAAAATGAGCCAAGG - Intronic
1118931015 14:70240480-70240502 CACCTTTGATTAATATTCCATGG - Intergenic
1118953892 14:70461824-70461846 CACCTTTGATTAATATTCCATGG + Intergenic
1120012869 14:79437029-79437051 CACCATGGATTAGTGATTCATGG - Intronic
1120724044 14:87917547-87917569 CAACATTTATATATGATCTATGG - Intronic
1125905985 15:43393097-43393119 AACCATTGATAAATGCAACATGG - Intronic
1129679108 15:77647936-77647958 CACCATTGCTAACTGATGGATGG + Intronic
1130789902 15:87143054-87143076 TACCTTTCAAAAATGATCCATGG + Intergenic
1133640406 16:7711272-7711294 AACCATTGATAAATGATTGTTGG - Exonic
1136073644 16:27803911-27803933 CACGATTGATAGATGATGGATGG + Intronic
1137025327 16:35468399-35468421 CACCATTCATACATGATCGGAGG - Intergenic
1137937564 16:52649202-52649224 TTCCATTGATAAAAGATCCTAGG - Intergenic
1143353570 17:6307618-6307640 CCCCATGGACAAATGAACCAAGG - Intergenic
1144471642 17:15547905-15547927 CACCATTAATTAAACATCCATGG - Intronic
1144924836 17:18796801-18796823 CACCATTAATTAAACATCCATGG + Intronic
1155032728 18:21998351-21998373 CACATTTTATAAATGATCAATGG - Intergenic
1155983231 18:32202828-32202850 CACCACTGAAAAATCTTCCATGG - Intronic
1156033082 18:32735735-32735757 CAGCATTAATAAATAATCCCAGG - Intronic
1158359902 18:56660188-56660210 CACCATTGAGGAATGATCAGGGG + Intronic
1166635403 19:44447188-44447210 CACCATGGATAAATAATACCTGG + Intronic
931393851 2:61868362-61868384 CATCACTGATAAATGCTCCCTGG - Exonic
936240447 2:110783916-110783938 CACCAGTGACAAATGAGGCATGG - Intronic
938382124 2:130842618-130842640 CACCATTGATAATTTATTTAGGG + Intronic
939839657 2:147171812-147171834 CACCATTGGCAAACGATCTAGGG - Intergenic
940538346 2:154976690-154976712 CAACATTTATAAATGTTCTAAGG + Intergenic
940838045 2:158547340-158547362 AACCATTGATACATGCACCATGG + Intronic
943846031 2:192649380-192649402 CCCCATTTATAAATGATGGAAGG - Intergenic
946062133 2:216951861-216951883 CCCCATTGAAAAATGAGCAAAGG - Intergenic
1172905149 20:38363782-38363804 CACCATTGTTAACTCATCCAAGG + Intronic
1176055835 20:63148493-63148515 CTCCATTGATAGAGGATGCATGG - Intergenic
1177520303 21:22213245-22213267 CAACATTGAGAAATAATACATGG - Intergenic
1178138117 21:29651174-29651196 CATCATTGAGAAGTGGTCCATGG - Exonic
1181777202 22:25168388-25168410 TACAATTGATAAGTCATCCAGGG + Intronic
949106472 3:205786-205808 AACACTTGATAAATGATCAATGG - Intronic
950994026 3:17475054-17475076 CACAATTGAAAAATGACCAAAGG - Intronic
951329278 3:21345857-21345879 AACTATTGCTAAATGAACCAAGG + Intergenic
959313001 3:104764504-104764526 CAAAATTAATATATGATCCAGGG + Intergenic
960574126 3:119212983-119213005 AACCATTGCTAACTGATCCTTGG + Intronic
966681203 3:182643728-182643750 CACCAGAGCTAAATGCTCCAAGG + Intergenic
971019327 4:22517563-22517585 CAACACTGATAAATGATAAATGG - Intergenic
972309657 4:37868231-37868253 GGCCATTGATAACTGATCCTTGG - Intergenic
974197966 4:58601126-58601148 CACCATTAATAAATAAAGCAAGG + Intergenic
974799182 4:66793433-66793455 CATCATGGTTAAATGATACATGG + Intergenic
977819070 4:101451108-101451130 CCCCACTGATAAATGAGCTATGG + Intronic
979090378 4:116476723-116476745 CCCCATTAAAAAATGAGCCAAGG + Intergenic
980745715 4:137011943-137011965 CATCATGGATCAAAGATCCAGGG - Intergenic
983529633 4:168796019-168796041 CACAAAGGATAAATGATTCAGGG - Intronic
985710916 5:1429302-1429324 CACAAATGATTAATGACCCAAGG - Intronic
986559091 5:9042674-9042696 GACCATTGTTGAATGAGCCAGGG - Exonic
986947080 5:13035295-13035317 GACCTTTGATAAATGACCAAAGG + Intergenic
988071958 5:26302342-26302364 CACAATTTAAAAATGATCAAAGG - Intergenic
990772172 5:59260600-59260622 GACTATTAAGAAATGATCCATGG + Intronic
992296237 5:75329619-75329641 CACCATTAAGAAATAATCTAGGG - Intergenic
993332395 5:86616944-86616966 AACCAGTGATAAATGAACCTGGG - Intergenic
994669242 5:102746807-102746829 CTCCATTAATCAATGCTCCATGG - Intergenic
996230862 5:121061666-121061688 CACCATTCCTAGATGAACCAAGG + Intergenic
996350579 5:122536860-122536882 CACCAATAATAAATGATTCTGGG + Intergenic
999766960 5:154748344-154748366 CACCATTGATAAGTACTCCAAGG + Intronic
1002914950 6:1521519-1521541 AACAATTGAAAAATGATCAAGGG - Intergenic
1003810651 6:9776218-9776240 GACCATTGATACAAGATGCAGGG - Intronic
1004838132 6:19551386-19551408 GACCATGGATAAACAATCCATGG - Intergenic
1005790270 6:29292934-29292956 CTCCATGTATAAATGAACCATGG - Intergenic
1007059560 6:38925236-38925258 CACCTTTGTTAAATTATCCCAGG - Intronic
1008472809 6:51902678-51902700 CTCCTTTGATAGAAGATCCATGG + Intronic
1009547336 6:65036637-65036659 CACCATTGAAAAATGGGCAAAGG + Intronic
1011150951 6:84272816-84272838 CTCAATGGATAAATGATCGAGGG - Intergenic
1011459069 6:87584612-87584634 CACCATTATTAAGTGCTCCATGG + Intronic
1012801530 6:103835217-103835239 AACCATTAAAAAATGATCAAAGG - Intergenic
1012818394 6:104053931-104053953 CACCAGAGAAAAATGATTCATGG + Intergenic
1013251313 6:108336471-108336493 TAGCATTAAAAAATGATCCAAGG - Intronic
1013883818 6:114937185-114937207 CACCAATGATAAATGCTTGAGGG - Intergenic
1014471761 6:121824022-121824044 GACCATTGATAAATGACCCATGG + Intergenic
1018322378 6:162625247-162625269 CTGCAGTGATAATTGATCCAGGG - Intronic
1023684905 7:42723950-42723972 GACAATTGATAAATGCTGCAAGG + Intergenic
1024421943 7:49178402-49178424 CACCAGTGAAAAATAAGCCATGG - Intergenic
1030380904 7:108810901-108810923 GACCTCTGATGAATGATCCAAGG - Intergenic
1035452394 7:158985858-158985880 CACCCTTGATGAATGAGCCCCGG - Intergenic
1041978763 8:63831223-63831245 AGCCATTGTAAAATGATCCAGGG - Intergenic
1045864496 8:106849834-106849856 AACAATTTCTAAATGATCCAAGG + Intergenic
1045911977 8:107420693-107420715 CAGCATTCATATATGGTCCATGG + Intronic
1045928694 8:107599493-107599515 CACCAAGGAAAAATGATCCGAGG - Intergenic
1048182937 8:132213088-132213110 CACCATTGATAAATGATCCATGG - Intronic
1048513742 8:135086233-135086255 CAGCATTGATAGAGAATCCAGGG + Intergenic
1048579802 8:135721553-135721575 TAGCATTGATAAATGGGCCATGG - Intergenic
1050498710 9:6271417-6271439 CACCATTTAGATATGATGCATGG + Intergenic
1051265337 9:15304274-15304296 CAACATTGATAATGGATTCATGG - Intronic
1052620688 9:30905382-30905404 CACTATTGATTAATGCACCATGG + Intergenic
1053591012 9:39514737-39514759 TACCATTAATAAATGTTACAAGG - Intergenic
1054575294 9:66850553-66850575 TACCATTAATAAATGTTACAAGG + Intergenic
1055471375 9:76614836-76614858 CACCTTTTCAAAATGATCCAGGG + Intronic
1056912568 9:90716178-90716200 AACCATTCATAGAGGATCCATGG - Intergenic
1057728582 9:97588411-97588433 CACAATTTATAAATGAGCAAAGG - Intronic
1187991663 X:24880786-24880808 AACCATTTATAAATGTTCCGGGG - Intronic
1195714461 X:107805119-107805141 CTCCATTTAAAAATGATCAAAGG + Intergenic
1197502426 X:127258324-127258346 CACAATTGAAAATTCATCCAAGG - Intergenic
1199706081 X:150426588-150426610 CACCTGAGATAAATGATCCCTGG + Intronic