ID: 1048183423 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:132216850-132216872 |
| Sequence | ATGGGCAAGAAGAAGTGTGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048183420_1048183423 | 16 | Left | 1048183420 | 8:132216811-132216833 | CCTGTTAGAGTCATGTTACTCAG | 0: 1 1: 0 2: 0 3: 5 4: 71 |
||
| Right | 1048183423 | 8:132216850-132216872 | ATGGGCAAGAAGAAGTGTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048183423 | Original CRISPR | ATGGGCAAGAAGAAGTGTGC TGG | Intronic | ||
| No off target data available for this crispr | |||||