ID: 1048183423

View in Genome Browser
Species Human (GRCh38)
Location 8:132216850-132216872
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048183420_1048183423 16 Left 1048183420 8:132216811-132216833 CCTGTTAGAGTCATGTTACTCAG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1048183423 8:132216850-132216872 ATGGGCAAGAAGAAGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr