ID: 1048185754

View in Genome Browser
Species Human (GRCh38)
Location 8:132239083-132239105
Sequence TAAGGGGCCCAGGAATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048185754_1048185759 -5 Left 1048185754 8:132239083-132239105 CCAAGAAATTCCTGGGCCCCTTA 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1048185759 8:132239101-132239123 CCTTAATTCATACAATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048185754 Original CRISPR TAAGGGGCCCAGGAATTTCT TGG (reversed) Intronic
901500433 1:9649586-9649608 TGAGAGGCCCAGGCATCTCTTGG + Intergenic
902072677 1:13754099-13754121 TAAGTGACACAGGAAGTTCTAGG + Intronic
902523770 1:17040350-17040372 TCATGGGCTCAGGAAATTCTTGG + Intronic
908650723 1:66329876-66329898 TCAGGTGCCCAGGTATTTGTAGG + Intronic
910064897 1:83141224-83141246 AAAGGGGCCAAGGAATAGCTTGG + Intergenic
910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG + Intergenic
914857380 1:151362619-151362641 AAAGGGGCCCAGGTATAGCTTGG + Intergenic
915245397 1:154552654-154552676 CAAGGGGCCCAAGAGGTTCTGGG - Intronic
915959681 1:160255052-160255074 AAAGAGGTCCAGGATTTTCTAGG - Intronic
919487806 1:198165679-198165701 TAAGGGCCCTAGGATTTTCAGGG + Intronic
920493293 1:206435885-206435907 TAATGTGCACAAGAATTTCTTGG - Intronic
920747566 1:208643438-208643460 GGAGGGGCTCAGGAATTGCTGGG + Intergenic
920774142 1:208919723-208919745 TAAGGGGGCCTGGAAGTACTGGG + Intergenic
920840197 1:209547510-209547532 TCTGGGGCCTAGGTATTTCTTGG - Intergenic
922556938 1:226539721-226539743 AAAGAGGCCCAGAAATTTATTGG - Intergenic
1066119635 10:32272662-32272684 TGAGGGGCCTATCAATTTCTAGG - Intronic
1071824461 10:89310963-89310985 GAAGGGTTTCAGGAATTTCTAGG - Intronic
1072130619 10:92490688-92490710 TAAGAGGCCCAGCACATTCTTGG - Intronic
1072881104 10:99230751-99230773 TAAGAGCCCCAGGAATTGCTGGG - Intronic
1073589205 10:104740238-104740260 AAAGGGGGCCACAAATTTCTAGG - Intronic
1074924561 10:118054623-118054645 TAAGGAGGCCAGCAATTACTAGG - Intergenic
1075318763 10:121472692-121472714 TCAGGGGCTGCGGAATTTCTGGG - Intergenic
1077663522 11:4089401-4089423 CAAGGTGCCAAGGAAGTTCTGGG - Intronic
1079325819 11:19491157-19491179 TAAGGGCCCTAGGATTTTCAGGG + Intronic
1083126933 11:60578800-60578822 TAAGGGGGACTGGAATTTTTGGG + Intergenic
1088993617 11:114976728-114976750 TAAGGGGCCCAGCCACATCTGGG + Intergenic
1089155804 11:116401429-116401451 AAGGGGGCCCAGGATTTTATAGG - Intergenic
1089798889 11:121007149-121007171 TAAGGAGCCCAGACATCTCTGGG - Intergenic
1093823631 12:23653611-23653633 TAAGGGCACCAGCAAATTCTGGG + Intronic
1099984652 12:89648889-89648911 AAAGGGGCCCAGGAACAGCTTGG + Intronic
1105377914 13:19862548-19862570 TAAGAGGCCAAGGAGTTCCTGGG + Intronic
1106487549 13:30185620-30185642 TATGGGGCACAGGCTTTTCTTGG + Intergenic
1107817704 13:44258925-44258947 TAAGTGGCCCCGGAGTTTGTTGG - Intergenic
1110384302 13:74890894-74890916 TAAGTGCCCAATGAATTTCTTGG - Intergenic
1110616157 13:77544495-77544517 GAACTGGCCCAGGAAATTCTTGG + Intronic
1110901849 13:80834319-80834341 AAAGGGGCCCAGGTATACCTCGG - Intergenic
1112999739 13:105620261-105620283 CAAGGGGCAAAGGAATTTATAGG + Intergenic
1117313782 14:54554473-54554495 TAAGGAGCTCAGAAATATCTTGG - Intergenic
1117488525 14:56223284-56223306 TAAGGGGCAGAGGAATTCTTAGG + Intronic
1117732254 14:58735055-58735077 TAATGTGCACAGGAATTACTTGG - Intergenic
1120700047 14:87689485-87689507 CAATGAGCCCAGGAATTACTTGG - Intergenic
1124815852 15:32991222-32991244 TCAGGGACCCAGGAGATTCTGGG - Intronic
1127964005 15:63910425-63910447 TAGGGTGCTCAGGAATGTCTGGG - Intronic
1130135891 15:81181652-81181674 CAAGGGCCCCAGGTCTTTCTGGG - Intronic
1130162905 15:81419466-81419488 TAAGGGCCTCAGCAATTTCAGGG - Intergenic
1134032910 16:11006893-11006915 TTAGGGGCCCTGTGATTTCTTGG - Intronic
1138330486 16:56211397-56211419 TAGGAGGCCCAGGGAGTTCTGGG - Intronic
1138379538 16:56590440-56590462 TAAGGGGCCCAGGAAAGCCGTGG - Intronic
1140944464 16:79754955-79754977 TCAGGAACCCAGGGATTTCTGGG + Intergenic
1141112762 16:81283521-81283543 AGAGGGGCCCAGGAACATCTTGG + Intronic
1141382542 16:83589144-83589166 TAAAGGCCCCTGGAATTCCTTGG + Intronic
1143450759 17:7035663-7035685 TGAGGGGTCCAGGAATTGCAAGG - Intergenic
1143737466 17:8922975-8922997 GAAGGGGCACAGGAATGCCTGGG + Intronic
1146036175 17:29408638-29408660 AAAGGGGCCTAGGAAATTTTGGG - Intronic
1146455295 17:33004851-33004873 GATGGGGTCCAGGAAATTCTGGG - Intergenic
1147235140 17:39051546-39051568 CAGCTGGCCCAGGAATTTCTGGG - Intergenic
1149379866 17:56082575-56082597 ACAGAAGCCCAGGAATTTCTAGG + Intergenic
1149957973 17:61074927-61074949 TAATGGGCCCAGGACTTCCAGGG - Exonic
1153864463 18:9250941-9250963 TAAGGAGTCCAGGAATATCCAGG + Intronic
1157107756 18:44790790-44790812 CTAGGGGCTCAGGAATTGCTTGG + Intronic
1157321904 18:46641147-46641169 TAAGGGGCACATGAATATCCTGG - Intronic
1157434206 18:47654734-47654756 TCAGGCTCCCAGGAATTCCTAGG - Intergenic
1160086976 18:75785554-75785576 TAAGAAGCCAAGAAATTTCTTGG + Intergenic
1161161385 19:2763424-2763446 CAAGGGGCCCAGGGATCTCCGGG + Intronic
1161425762 19:4202180-4202202 AAAGGGGCCAAGGAATATCTAGG - Intronic
1163056817 19:14726162-14726184 AAAGGGGCCCAGGTATAGCTTGG - Intronic
1163118155 19:15200411-15200433 TTGGGGGCCCAGGTACTTCTAGG - Intronic
1166956447 19:46468645-46468667 TCAGGGACCCAGAAATTTCTTGG - Intronic
1167409233 19:49335270-49335292 TGAGGGGCCTTGGAATTTGTGGG - Intronic
1167515849 19:49922803-49922825 TCAGGGGCCCAGGTGCTTCTGGG + Intronic
926013293 2:9425134-9425156 TGGGGGGCCCAGGATGTTCTAGG + Intronic
927963296 2:27254286-27254308 TAAGGAGCCAAGGAATCCCTGGG - Intronic
929978417 2:46656613-46656635 TTATGGCCCCAGGAATTTCAAGG - Intergenic
930740544 2:54828048-54828070 TAATGTGCCCATGAGTTTCTGGG + Intronic
930743428 2:54857136-54857158 TAAGGGGAAGAGGAATGTCTCGG + Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
933485015 2:82910038-82910060 TAACAGGCTAAGGAATTTCTAGG + Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
937117820 2:119421379-119421401 AAAGGGTCCCAGGAACTGCTTGG - Intergenic
938195598 2:129324708-129324730 TCAGGGGCCCAGGACTGTCTGGG - Intergenic
938373762 2:130790739-130790761 TAAGGGTTCCAGGAACTTCCCGG + Intergenic
940566911 2:155376501-155376523 TAACGGGCCCAGAAGTTTGTAGG + Intergenic
941992170 2:171568103-171568125 TAGAGGGGCCAGGAATTGCTGGG - Intergenic
942831501 2:180241679-180241701 AAAGGGGCTCAGGAATTGATAGG + Intergenic
943729931 2:191291635-191291657 TAACCAGCCCAGGCATTTCTAGG - Intronic
947632537 2:231663383-231663405 TAATGGGCCCAGGACTGTTTGGG + Intergenic
947739084 2:232476756-232476778 TTAGTGGCCCTGGGATTTCTGGG - Intergenic
1169787784 20:9378802-9378824 TATGGGGCCCAGCCTTTTCTGGG - Intronic
1172875044 20:38158919-38158941 TCCGGGCCCCGGGAATTTCTTGG + Intronic
1175855340 20:62118082-62118104 TTAGGGGCTCAGGAATGGCTGGG - Intergenic
1178337212 21:31754098-31754120 TAATTGACCAAGGAATTTCTAGG - Intergenic
1179087894 21:38236707-38236729 TAAGGGACACTGGAATTTCCAGG - Intronic
1179398704 21:41064395-41064417 TAATGGTCCCTGGAGTTTCTCGG + Intergenic
1184532132 22:45062722-45062744 TAATGGACCCAGGATCTTCTAGG - Intergenic
1184555879 22:45232890-45232912 TCAGGGGCACAGGTATCTCTGGG + Intronic
1184801509 22:46763111-46763133 CAAGGAGCCCAGGAGTTTCTCGG - Intronic
1184812467 22:46845733-46845755 TAAGGAGCTCAACAATTTCTTGG - Intronic
1185416006 22:50710584-50710606 AAAGGGGCCCAGAAATTACAGGG - Intergenic
950528140 3:13536531-13536553 TGAGGGACCCAGGGACTTCTGGG - Intergenic
955520938 3:59775017-59775039 TAATGTGCCTATGAATTTCTTGG - Intronic
959684638 3:109131003-109131025 TCAAGGACCCAGGAATTTCAAGG + Intergenic
960700759 3:120437111-120437133 GAAGGGGATCAGAAATTTCTCGG + Intronic
961976776 3:131034120-131034142 TAAGGGCCAAAGTAATTTCTGGG - Intronic
962197437 3:133376424-133376446 TAAGGGCCCGGGGAATCTCTGGG - Intronic
970822692 4:20237438-20237460 TAAGGTGCTCAGGAATTTCAGGG + Intergenic
974734349 4:65910371-65910393 TAAGGGGCACAGGAAATTTTGGG - Intergenic
981098072 4:140802059-140802081 TAAGGGTCCTAGGAATCTCTTGG - Intergenic
984314718 4:178113235-178113257 TAAGAGGGCCTGGAACTTCTTGG + Intergenic
985349125 4:189038922-189038944 TAAATCGCCCAGGAATTTCTAGG - Intergenic
987261679 5:16210773-16210795 TAAGGGTCCAAGGATTCTCTTGG + Intergenic
988332670 5:29862918-29862940 TAATGGGCCTATCAATTTCTGGG - Intergenic
988456144 5:31388821-31388843 AAAGGGGCCCAGGTATGCCTTGG - Intergenic
989115168 5:37945536-37945558 TCAGGAGCCCAGGAGTTTCTGGG + Intergenic
994107750 5:95965160-95965182 TAAAGGGCTCAGTGATTTCTTGG + Intergenic
994132845 5:96250329-96250351 TCAGGGCCCCAGGACCTTCTAGG + Intergenic
994808235 5:104479282-104479304 AAAGGGGCCAAGGTATGTCTGGG + Intergenic
996216943 5:120879911-120879933 TAAGGGGCTCATAAATTTGTGGG - Intergenic
998087590 5:139339446-139339468 TCAGGGGCCCAGTATTTCCTTGG - Intergenic
999544513 5:152612438-152612460 TAAAGGAGCCAGGACTTTCTGGG - Intergenic
1000165122 5:158640825-158640847 TCAGGGGCCCTGTCATTTCTTGG + Intergenic
1001840989 5:174876523-174876545 AAGGGGGCACAGGAATTTCAGGG + Intergenic
1002794045 6:456505-456527 AAAGGGGCCCAGGTATAGCTTGG - Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1004190908 6:13462642-13462664 TAAGGGGCCCAGGAAATGATGGG - Intronic
1007061569 6:38945630-38945652 TAAGCGGCCCAGGTATGTTTGGG - Intronic
1008906381 6:56681803-56681825 TAAGGAGACCAGGATTCTCTTGG + Intronic
1009438430 6:63645565-63645587 TAAGGAGCCCAGGATGTTATAGG + Intronic
1012232373 6:96775367-96775389 ATAGGGGCCCAAAAATTTCTAGG - Intergenic
1012438108 6:99236356-99236378 TACAGGGTCCAGGATTTTCTTGG - Intergenic
1016381532 6:143488003-143488025 TCAGGGGCCCAAGAATTTGAGGG - Intronic
1017745997 6:157447386-157447408 TAAGGGGCTCAGGGTCTTCTGGG - Intronic
1019168217 6:170113066-170113088 AAAGGTGCCCAGGACTTTCCTGG - Intergenic
1019770551 7:2881477-2881499 TATGGGACCCAGGGAATTCTGGG - Intergenic
1021808654 7:24381367-24381389 AAAGGAGCCCAGTAACTTCTCGG - Intergenic
1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG + Intergenic
1025622942 7:63190899-63190921 TAAAGGGGCCAGGATTTCCTTGG + Intergenic
1026937042 7:74263508-74263530 CAAGGCGCCCAGGAAGCTCTTGG - Intergenic
1027225539 7:76241356-76241378 GAAGAGGCCCAGGCAATTCTCGG + Intronic
1029420017 7:100467509-100467531 TAAGGGGGCCAGGACCTCCTGGG + Intronic
1034590826 7:152137523-152137545 GGGGAGGCCCAGGAATTTCTAGG + Intronic
1037757452 8:21720379-21720401 AAAGGGGGCAAGGAGTTTCTGGG + Intronic
1037878421 8:22560927-22560949 CAAGGTGCCTGGGAATTTCTGGG - Intronic
1040625492 8:49144716-49144738 TAAGGGGCACAGGAACTTTGGGG + Intergenic
1041682209 8:60605141-60605163 AAAGGGGCCCAGGAAGAGCTCGG + Intronic
1044744853 8:95362155-95362177 TAAGGGCCCCATGAGTTTCAGGG + Intergenic
1046014135 8:108585842-108585864 AAGGGGGCCCAGCTATTTCTTGG - Intergenic
1046904075 8:119553643-119553665 TAATGGGCACAGGAAGTTTTGGG + Intergenic
1048185754 8:132239083-132239105 TAAGGGGCCCAGGAATTTCTTGG - Intronic
1048496465 8:134939939-134939961 TACGGGGCCCAGCGATTTGTAGG + Intergenic
1049862923 8:144912648-144912670 AAAGGGGCCAAGGAATAGCTTGG + Intergenic
1050424360 9:5498649-5498671 AATGGGGACAAGGAATTTCTGGG - Intergenic
1051352623 9:16212802-16212824 TCAGGGGCCAAGTAAATTCTGGG + Intronic
1051635675 9:19179033-19179055 TCAGGGGCTCAGGACTTTCCTGG - Intergenic
1055724883 9:79216936-79216958 TAAGGGCTCCATGAATTCCTAGG - Intergenic
1058447160 9:105064423-105064445 GAATGCACCCAGGAATTTCTAGG + Intergenic
1059599592 9:115762266-115762288 TTATGGGCCCAGGTATTTGTGGG + Intergenic
1061809612 9:133154776-133154798 TTAGGGCCCCAGGAAGTTCCAGG + Intronic
1186876222 X:13820634-13820656 TAAGGGGACCAGGAATGTCAGGG - Intronic
1187210404 X:17225047-17225069 TTAGGGGTCCAAGAATTTCTAGG - Intergenic
1187293072 X:17973848-17973870 GATGGGGCCCAAGAATTTGTTGG - Intergenic
1193527552 X:82612126-82612148 AAAGGGGCCCAGGTATATCTAGG + Intergenic
1197808432 X:130418994-130419016 CAAGGGGCTCAGGACTTTTTGGG - Intergenic
1199085107 X:143618876-143618898 TAAAGGGACCAGGAATTGCATGG + Intergenic