ID: 1048187170

View in Genome Browser
Species Human (GRCh38)
Location 8:132251957-132251979
Sequence AAGGATCCAGAAGATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048187170_1048187173 13 Left 1048187170 8:132251957-132251979 CCTTTCTCATCTTCTGGATCCTT 0: 1
1: 0
2: 4
3: 30
4: 456
Right 1048187173 8:132251993-132252015 GTAGAATCTTTGTGTTGGTGTGG No data
1048187170_1048187172 8 Left 1048187170 8:132251957-132251979 CCTTTCTCATCTTCTGGATCCTT 0: 1
1: 0
2: 4
3: 30
4: 456
Right 1048187172 8:132251988-132252010 ATTCTGTAGAATCTTTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048187170 Original CRISPR AAGGATCCAGAAGATGAGAA AGG (reversed) Intronic
901190328 1:7406160-7406182 TTGGCTCCAGAGGATGAGAAGGG + Intronic
901372810 1:8815038-8815060 AAAGATCCAGACGAAGAGGATGG - Intronic
901488109 1:9579500-9579522 AAGGATACAGAAGAAGAGACAGG + Intronic
901951789 1:12755442-12755464 AGGGAGAGAGAAGATGAGAAAGG + Intronic
902053975 1:13584885-13584907 AAGGCTCCAGGAGAGGACAAAGG - Intronic
902725459 1:18332924-18332946 AAGGAGCCAGAAGACGAAGATGG + Intronic
903198166 1:21709226-21709248 AAAGATCCAGAAGAGGTGAGGGG - Intronic
903324457 1:22562211-22562233 AAGGAAACAGAAGCTCAGAAAGG - Intergenic
903354521 1:22738235-22738257 AAGGAACAAGAAAATGACAAAGG - Intronic
904033306 1:27546561-27546583 AGGGACCCAGAAGTGGAGAAGGG - Intronic
904373755 1:30066642-30066664 AAGGATTGAGAAGATAAAAAAGG - Intergenic
905409565 1:37759079-37759101 TAGGAGCCAGAAGATGAAGAAGG - Intronic
905688294 1:39924728-39924750 GAGGATCCAGAGGAGGAGAATGG + Intergenic
905832153 1:41078837-41078859 AAGGATGAAGAACACGAGAAAGG + Intronic
905960240 1:42036482-42036504 GAGGGTCTAGAAGATGTGAAGGG + Intergenic
906056542 1:42922486-42922508 AAAGAAACAGAAGATCAGAAAGG + Intergenic
907366664 1:53966643-53966665 TAGAATACAGAAGATGAAAAAGG + Intronic
907488719 1:54795121-54795143 GAGGAAACAGAAGATGAGATTGG + Intronic
908719589 1:67110352-67110374 AAAGATCCAGAAGAGGAAAGTGG + Intronic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
909921019 1:81379963-81379985 AATGATACAGAAGAGGGGAAGGG - Intronic
910067793 1:83174421-83174443 AATGGTCCAGAAGATCAGAGAGG + Intergenic
910635460 1:89403181-89403203 AGGGATCAATAAAATGAGAAGGG - Intergenic
910747355 1:90588373-90588395 AAAGCTCCAAAAGATGAAAAGGG + Intergenic
910757788 1:90710118-90710140 AAGCAGGCAGAAAATGAGAAGGG + Intergenic
915062634 1:153198904-153198926 AAGGATTCAACAGAGGAGAAAGG + Intergenic
915625387 1:157111331-157111353 AAGGAGCCAGTGGAGGAGAAGGG - Intergenic
915840235 1:159207352-159207374 AAAGATCAAGAAGTTGTGAAGGG + Intergenic
916289696 1:163151323-163151345 AAGGATAAAGAAGAGTAGAAAGG + Intronic
916434600 1:164766156-164766178 CAAAATCCAGAAGCTGAGAAGGG + Intronic
916544676 1:165792597-165792619 AAGGATCCAGAGGAAAAAAATGG + Intronic
917015337 1:170525119-170525141 AAGGAGTCAGAAAATGAGTAAGG + Intergenic
917474787 1:175359870-175359892 ATGGAACCAGAAGAGGAGAAAGG - Intronic
917871376 1:179245054-179245076 AATTATTCTGAAGATGAGAATGG + Intergenic
918091556 1:181299585-181299607 AAAGATCCAGGAAATTAGAAAGG - Intergenic
918490492 1:185076237-185076259 AAAGATCTAGAAGAAAAGAAGGG - Intronic
919193208 1:194249899-194249921 AAACATCCAGCAGATCAGAAAGG + Intergenic
920056545 1:203196995-203197017 AAGGTTCCAGAAGATGAGTCTGG - Intergenic
920641303 1:207753937-207753959 AAGGATCAAGAAAATAGGAATGG - Intronic
921233550 1:213099100-213099122 AAGGATACACAAGTAGAGAATGG + Intronic
921302546 1:213764813-213764835 AAGGTTCCAAAAAATTAGAAGGG + Intergenic
921433621 1:215091148-215091170 GAAGATACAGAAGATGTGAAAGG + Intronic
922477260 1:225915200-225915222 AAGGATGCAGGAGATGAGGGAGG + Intronic
923132443 1:231088383-231088405 AAGGATATAGAAGATTTGAAGGG + Intergenic
923729858 1:236539716-236539738 CAGTATCCCGAAGATCAGAAAGG - Intronic
924445399 1:244125183-244125205 AAGGTTGCAGAAGAGGAGAGTGG + Intergenic
1063022566 10:2144330-2144352 CAGGACCCAGAAGAAGACAAAGG + Intergenic
1064230416 10:13525103-13525125 AAGGAAGCAGAACATGAGAGAGG - Intronic
1064499256 10:15951238-15951260 ACAAATCCAGAAGCTGAGAAGGG - Intergenic
1068248571 10:54406471-54406493 AAAGAGGCAGAAGAGGAGAAAGG - Intronic
1069166185 10:65162966-65162988 AAGTAGACAGAAGATTAGAAAGG + Intergenic
1069224907 10:65930795-65930817 AAGGATCAAGAATATGTAAAAGG - Intronic
1070279074 10:75035786-75035808 AAGGCAACAGAAGCTGAGAATGG - Intergenic
1070304461 10:75231790-75231812 AAGCATACAGAAGAGGAGTAAGG + Intergenic
1072798877 10:98377949-98377971 AAGGAAGGAGAAGAGGAGAAAGG - Intergenic
1073877398 10:107940818-107940840 AAGTATAAAGAAGCTGAGAAAGG + Intergenic
1074218749 10:111414418-111414440 AAGGAGACAGAAAAAGAGAAAGG + Intergenic
1074756728 10:116629303-116629325 AAGGATACAGAAGCTCAGAGAGG + Intronic
1077903338 11:6508792-6508814 GAGGATACAGGAGATGAAAAAGG - Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078942233 11:16020334-16020356 AAGGATCAGGCAGATCAGAAAGG - Intronic
1079074995 11:17379328-17379350 AAGGATCCAGCTGATCATAAAGG - Intergenic
1079179694 11:18179451-18179473 AAGGATACAGAATGTCAGAATGG + Intronic
1079549769 11:21680431-21680453 AAGGGTAAAGAAGAGGAGAAAGG + Intergenic
1079617576 11:22513989-22514011 ATGGATTGAGAAGACGAGAAGGG - Intergenic
1079763419 11:24358204-24358226 AAGACTCCAGAATGTGAGAAGGG - Intergenic
1080910771 11:36595830-36595852 AAGGTTGGAGAGGATGAGAAGGG + Intronic
1081161383 11:39754361-39754383 GTGGATCCTGAAGATGTGAATGG - Intergenic
1081369373 11:42280885-42280907 AAGCATCCAGCACAGGAGAAAGG + Intergenic
1081760176 11:45571466-45571488 AAAGTTCCAGAAGAAGAAAATGG - Intergenic
1081843703 11:46223068-46223090 AAGGCTCCAGAGGATCAGAAAGG + Intergenic
1082098082 11:48147589-48147611 AAGGATGCAGAAGCTGAGTCAGG + Intronic
1082969736 11:59006879-59006901 AAGGAGCCAGTAGAAGAGATCGG + Intronic
1083379129 11:62250481-62250503 AAGCACCGAGAAGATGAGGATGG + Intergenic
1084169738 11:67395256-67395278 AAGCATGCAAAAGATGAGCAAGG - Intronic
1084988109 11:72895613-72895635 AAGGAACCAGATCAGGAGAAAGG + Intronic
1085278037 11:75312422-75312444 AAGGCCCCAGGAGAGGAGAAAGG + Intronic
1085308176 11:75500191-75500213 AAGGAGCCAGAAGAGGAGAGAGG - Intronic
1085376895 11:76071881-76071903 AAAGATCCAGGAGATGGGAGTGG + Intronic
1085404937 11:76256185-76256207 AAGGATCAAGCAGATTAAAAGGG + Intergenic
1085551734 11:77379804-77379826 AAGCATCAGGAAGATGAGAAAGG + Intronic
1087202100 11:95356032-95356054 AATGAACAAGAAGAAGAGAAAGG - Intergenic
1091148414 11:133301849-133301871 ATGGATCCAGAAGATGTCATTGG - Intronic
1091482204 12:844691-844713 TAGAAGCCAGAAGATGGGAATGG - Intronic
1092070377 12:5626882-5626904 AAGCATCCAGAAGAGAAGGAAGG - Intronic
1092209896 12:6639320-6639342 AAGGGTCCAGAACATGGGACAGG + Intronic
1092774639 12:11931874-11931896 AGGGAACCAGACGATGAAAAGGG + Intergenic
1092944710 12:13441912-13441934 GAGGATCCACCAGATGAGGAAGG - Intergenic
1092955356 12:13544341-13544363 AAAGCTCCAGGAGATGAGAAGGG - Exonic
1093572270 12:20680203-20680225 AAGGAAGAAGAAGAAGAGAAAGG + Exonic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1093894076 12:24557524-24557546 AAGGAATCAGGAGAGGAGAAAGG - Intergenic
1094215159 12:27932759-27932781 AAGGACCCAGAAGATGCTAAAGG + Intergenic
1094688880 12:32749229-32749251 AAGGATACAGACTATGAGAGGGG + Intronic
1095709562 12:45274073-45274095 AAGGATCCAGCAGGAGAGATTGG - Intronic
1095895762 12:47279020-47279042 AAAGTCCCAGAAGATGACAATGG + Intergenic
1097539683 12:60924354-60924376 TAGGATCCAGAAACTGAAAAAGG - Intergenic
1097955436 12:65480726-65480748 AAGGACCCAGCACAGGAGAAAGG - Intronic
1098770660 12:74548680-74548702 AAGAATCAAGAAGAGGAGAAAGG + Intergenic
1099043016 12:77679616-77679638 AAGGATGCAGAGTATGAAAAGGG + Intergenic
1099330484 12:81278749-81278771 AAAGATGCAGAAGATGTGATAGG + Intronic
1099868117 12:88310160-88310182 CAGGATGCAGAAGATGAAAAGGG - Intergenic
1100588463 12:96001146-96001168 AAGGAGACAGAGGAGGAGAAAGG + Intronic
1100828043 12:98493076-98493098 AAGGATCAAGAAGATAGGTAAGG + Intronic
1101128733 12:101666477-101666499 AAGAATAGAGAAGAGGAGAAAGG - Intronic
1101514762 12:105424576-105424598 AAGGATCCAGATGATAAGCTGGG - Intergenic
1101835709 12:108293780-108293802 AAGGAAGCAGAAGTTCAGAAAGG + Intronic
1102347649 12:112169886-112169908 AAGCCTCTAGAAGATGAGAAGGG - Intronic
1103182551 12:118926303-118926325 AATGATCTAAAAGATGACAATGG + Intergenic
1103870999 12:124091741-124091763 AAGGAGCCAGAAGAGGAGATTGG + Intronic
1104075821 12:125388761-125388783 CAGGAGCCAGAAGACGAGCAGGG - Intronic
1104253122 12:127115414-127115436 AAGGTTCCTGTAGATGAGAGGGG - Intergenic
1104403863 12:128501235-128501257 AAGGATGCTGAAGACAAGAATGG - Intronic
1105544612 13:21342412-21342434 AGGGAGCAAGAAAATGAGAAGGG - Intergenic
1105737949 13:23291052-23291074 TAGGATCCAGAAGGGAAGAATGG + Intronic
1106169784 13:27279388-27279410 AATGATACAGAAGAGGGGAAGGG + Intergenic
1107479546 13:40774043-40774065 AAAATTCCAGAAGAAGAGAATGG - Intergenic
1107636808 13:42400446-42400468 AAGCATCCAGGAGATGGAAAGGG - Intergenic
1107979752 13:45723337-45723359 AAGCATCCAACAGATGACAAGGG + Intergenic
1108766489 13:53636994-53637016 AAGAATCCTGAATATAAGAATGG + Intergenic
1109339006 13:61030138-61030160 AAGGACACAGAAGATAAGAAAGG - Intergenic
1109415021 13:62027604-62027626 AAGGATCCAGATGATGAAGGGGG + Intergenic
1110634670 13:77752770-77752792 AAGCATCCAGCACAGGAGAAAGG + Intronic
1110942757 13:81370557-81370579 ATGGATCCAGAAGCAAAGAAGGG + Intergenic
1111090831 13:83444806-83444828 AACTATCCAAAACATGAGAAAGG + Intergenic
1111404673 13:87787921-87787943 AAGGATCAAGAATATGACACAGG - Intergenic
1111460232 13:88530866-88530888 AAGGATCAATAAGATTAAAAGGG - Intergenic
1113405392 13:110034210-110034232 AAGATTCGAGAAGATGATAAGGG + Intergenic
1114270073 14:21095303-21095325 AAGGATCCAGAGGATGAGAGTGG - Intronic
1114295452 14:21325162-21325184 AAGGATCAAGAACAAGACAAAGG - Intronic
1115280907 14:31662087-31662109 AATGATACAGAAGATTAGCATGG - Intronic
1116302303 14:43199314-43199336 AAGCATCCAGCACAGGAGAAAGG - Intergenic
1116543720 14:46135472-46135494 AAACATTCAGAAGATCAGAATGG + Intergenic
1116600653 14:46918027-46918049 AAGGAAGAAGATGATGAGAAGGG + Intronic
1116777929 14:49203020-49203042 AAGGATACAGAATCTGAGAGTGG + Intergenic
1118514887 14:66516434-66516456 AAGGATATAGTAGATTAGAAGGG - Intronic
1118775477 14:68971395-68971417 AAGGGAACAGAAGATGAGAGAGG - Intronic
1118866975 14:69711723-69711745 AAGCATCCAGAAGATCCCAAGGG + Exonic
1118868956 14:69725816-69725838 AAGGATACTGAAGAGAAGAATGG + Intergenic
1118950430 14:70431979-70432001 AAGCATCCAGCAGTGGAGAAAGG + Intergenic
1120744616 14:88142470-88142492 AATGATACAGAAGAGGGGAAAGG + Intergenic
1121687983 14:95853663-95853685 AAGGATCCACAAGATGCCCATGG - Intergenic
1123074109 14:105657994-105658016 AAGTAGCCAGATGATGACAAAGG - Intergenic
1123172129 14:106383341-106383363 ATGGTACCAGAAAATGAGAAAGG + Intergenic
1124081779 15:26505643-26505665 AAGGATTGAGAAGATGTAAAAGG - Intergenic
1124661343 15:31553241-31553263 AAGGAGCCAGCAGAAGAGACTGG - Intronic
1124807804 15:32904165-32904187 ATGGATCCAGAAGAGGAGCTAGG + Intronic
1124996404 15:34727252-34727274 ATGGAACAAAAAGATGAGAAAGG - Intergenic
1126244756 15:46491266-46491288 AAAGATACAGAAGAGCAGAATGG + Intergenic
1127751633 15:62050871-62050893 AGTGAACCAGAAGATGAAAATGG + Intronic
1128127570 15:65204349-65204371 AAGCATCCTGAAGATCACAAAGG - Exonic
1128782884 15:70374571-70374593 AAGGTCCCAGAATAGGAGAAAGG + Intergenic
1128831516 15:70773473-70773495 AATGATCCAGTAGAGGGGAAAGG + Intergenic
1129743837 15:78004245-78004267 AAGGAGTTAAAAGATGAGAAGGG + Intronic
1131176709 15:90213790-90213812 AAAAATCCAAAAGATAAGAAGGG + Intronic
1131692189 15:94839465-94839487 AAAGAAAAAGAAGATGAGAAAGG - Intergenic
1131822487 15:96286846-96286868 AAGGAAGCAGAACATGAGGAAGG + Intergenic
1132264791 15:100460477-100460499 AAGGATCCAGCAAACCAGAATGG - Intronic
1133053948 16:3135424-3135446 AAGTCACCAGAGGATGAGAATGG + Intronic
1133293528 16:4738185-4738207 AGCGATCAAGAAGAAGAGAAGGG - Intronic
1133485629 16:6215597-6215619 AAGTATCTAGAAGAAAAGAAAGG - Intronic
1133669721 16:8006622-8006644 AAGAATCCCGAAAAGGAGAATGG - Intergenic
1136030781 16:27501325-27501347 CAGGATTCAGAAGATGATCATGG - Exonic
1136039525 16:27566917-27566939 ATGGCTAGAGAAGATGAGAAAGG - Intronic
1136230152 16:28880967-28880989 GAGGATCAAGAGGATGACAAAGG - Exonic
1137378065 16:47971727-47971749 AAGGAGCAAGAAGAAAAGAAAGG - Intergenic
1137715890 16:50598115-50598137 AAGGGGCCAGGAGATGAGAGTGG + Intronic
1137889729 16:52146544-52146566 TGGGATCCAGAAGGTGAGACTGG - Intergenic
1138163432 16:54777362-54777384 AAAAATCCAGAAGTGGAGAACGG + Intergenic
1138332439 16:56225921-56225943 CAGGATGCAAATGATGAGAATGG + Intronic
1138462348 16:57157932-57157954 AAGGCTGTAGAAGATGAGAGGGG + Intronic
1140129053 16:72142713-72142735 AAGAATGCAGAAGAGGTGAAGGG + Intronic
1141296329 16:82773132-82773154 AATGATACAGAGGCTGAGAAAGG + Intronic
1141804960 16:86336355-86336377 AAGCAGACAGAAGATGAAAAGGG - Intergenic
1143278696 17:5733908-5733930 AAGGATGCAAAAGATGGGCAAGG + Intergenic
1143789328 17:9281192-9281214 AGTGATCCAGAAGATGACAGAGG + Intronic
1143893068 17:10117151-10117173 TGGGCTCCAGAAGCTGAGAAAGG - Intronic
1144824657 17:18098993-18099015 TAGGATGCAGAAGAGAAGAAAGG - Intronic
1145727164 17:27140819-27140841 AAAGAGGCAGAAGAGGAGAAAGG - Intergenic
1147154086 17:38534521-38534543 AAAGATCCAAAAGATAAGACAGG + Intronic
1147302855 17:39543767-39543789 AAGGATCCTGACTGTGAGAAAGG - Intronic
1147790959 17:43014079-43014101 AAGGAGCCAGGAGATGGCAAAGG - Intronic
1148283819 17:46370703-46370725 CAAGATCCAGAAGATGACATTGG - Intergenic
1149148902 17:53535151-53535173 AAGGACACACTAGATGAGAATGG + Intergenic
1150319445 17:64199892-64199914 AAGCATGCACAAGAAGAGAAAGG - Intronic
1151429047 17:74050248-74050270 TAGGACCCAGAGGATGACAACGG + Intergenic
1152405175 17:80094030-80094052 AAGAATCCCGAAGATAAGCAGGG - Intronic
1154122765 18:11665006-11665028 AAGAGTCAAGCAGATGAGAAGGG - Intergenic
1155965287 18:32029907-32029929 AAGCATCTAGAGGTTGAGAATGG + Intronic
1156540082 18:37901003-37901025 AATGACCCAGCAGAAGAGAAAGG - Intergenic
1156981744 18:43297983-43298005 AAGGAGATAGAAGATGTGAAGGG + Intergenic
1157914349 18:51650139-51650161 ATGCATCTAGAAGAAGAGAAGGG + Intergenic
1158097395 18:53789630-53789652 AAGGAAACAGAAGATCAGAGAGG + Intergenic
1158422635 18:57309525-57309547 TGGGATCCAGAAGCTGAGATGGG + Intergenic
1159171993 18:64782730-64782752 GAGGATGCTGAGGATGAGAATGG + Intergenic
1159392478 18:67810803-67810825 AAGCATCTAGATGATGATAATGG + Intergenic
1159687687 18:71443817-71443839 AAGGCTGCAGAAGCTGGGAAAGG - Intergenic
1161846253 19:6713455-6713477 CTGGATCCCGAAGATGACAAAGG + Exonic
1162162778 19:8731156-8731178 ACGGATCAAGAAGAGAAGAACGG - Exonic
1164565931 19:29326062-29326084 AAAGATCTAGCAGATGAAAAGGG - Intergenic
1164752782 19:30668919-30668941 AAGGAGCCAGAGGTTTAGAAGGG + Intronic
1165225840 19:34354010-34354032 ATGGATCCAGAAGAATTGAATGG + Exonic
1165683140 19:37794525-37794547 AATGATCAAGATTATGAGAATGG + Intronic
1166600559 19:44090534-44090556 AAGGAACTAGAATATGAGTATGG - Intergenic
1166672454 19:44719054-44719076 AAGGAGACAGAAGAGGAGCATGG + Intergenic
1167079598 19:47270334-47270356 GAGGATCAAGAAGATGGGAGAGG - Intronic
1168507093 19:56945417-56945439 AAGGAGGCAGAAGAAGGGAAAGG + Intergenic
925030044 2:643341-643363 AAGGACCCAGAAGAAGAGAGAGG + Intergenic
925114765 2:1369503-1369525 AGGGATCCAGCTGATGTGAAGGG - Intergenic
926379679 2:12274289-12274311 AAAAATACAAAAGATGAGAAGGG - Intergenic
926638940 2:15214463-15214485 AAGGATACAGAAGTCCAGAAAGG - Intronic
926687211 2:15707376-15707398 AAGCTTCCAGAAGCTGAGAGAGG + Intronic
926723852 2:15982560-15982582 AAGGATCCAGGAAGTGAGGAGGG + Intergenic
926825421 2:16901390-16901412 AATGATACAGAAGAGGAGGAAGG + Intergenic
927761399 2:25758514-25758536 GAGGAAACAGAAGATCAGAAGGG + Intronic
927881088 2:26690673-26690695 AGGGAGCCAGAAGATGCAAAGGG + Intergenic
928418014 2:31112816-31112838 AAGATTCCATAACATGAGAAAGG - Intronic
928843582 2:35641331-35641353 AAGGAAGCAGAAGATGAAAAAGG + Intergenic
929025831 2:37600737-37600759 AAAGTTCCAGAAAATGAGCAGGG - Intergenic
930028427 2:47043931-47043953 AAAGATGAAGAAAATGAGAAGGG + Intronic
930674817 2:54188975-54188997 AATGATCCAGGAGAAGAGAGAGG - Intronic
931112976 2:59133336-59133358 AAGGAAGCAGAAGATGGGACAGG - Intergenic
931786293 2:65622127-65622149 AGAGATCCAAAAGATGAGCAGGG + Intergenic
933000140 2:76911683-76911705 AAGGATGGAGAGGAAGAGAAAGG + Intronic
933398757 2:81765247-81765269 AATGATACAGAAGAGGGGAAGGG + Intergenic
933416111 2:81988341-81988363 AAGGATGCAAAAGAAGAGAAAGG - Intergenic
933741839 2:85539632-85539654 AAGGTTCCAGAAAACGTGAAGGG + Intronic
934129113 2:88930121-88930143 AAGATTCCAGAATATAAGAAAGG - Intergenic
935126911 2:100232332-100232354 AAGGGCCCAGAAGATGATTAAGG - Intergenic
935562765 2:104575884-104575906 AAAAATCTATAAGATGAGAAAGG - Intergenic
935563722 2:104584830-104584852 AAGGATCTAGAAGTTGTGCAGGG + Intergenic
935811362 2:106800695-106800717 GAGGATTCAGAGGAAGAGAAAGG - Intergenic
937085548 2:119169385-119169407 GAGGTTTCAGAAGATGAGAAAGG - Intergenic
937566728 2:123300893-123300915 AATTATCCAGAAGATCAAAAAGG + Intergenic
937717852 2:125055056-125055078 ATGGGTCCAGGAGGTGAGAAAGG + Intergenic
937759917 2:125588885-125588907 AAAGAACAAGAAGATAAGAAAGG + Intergenic
938730398 2:134142674-134142696 AATGAATCAGAAGCTGAGAAGGG + Intronic
939197980 2:138996859-138996881 AAGCATCCAGCACAGGAGAAAGG + Intergenic
940116146 2:150210598-150210620 AAGCAGCCAGAAGATGAAATGGG - Intergenic
940641319 2:156347147-156347169 ATGGATCCAGGAGATGAAGATGG + Intergenic
940645109 2:156383420-156383442 AATGTTGCAGGAGATGAGAAAGG + Intergenic
940937611 2:159515746-159515768 AAGTATTCAGAATATAAGAAGGG - Intronic
941113007 2:161438098-161438120 AAGGAAGTAGAAGAAGAGAAAGG - Intronic
941759343 2:169224159-169224181 AAAGATACTGAAGATGAGCAAGG - Intronic
941802913 2:169680684-169680706 AAGGATCCAGAAGAGGAGCAGGG + Intronic
942655912 2:178213894-178213916 AATGACACTGAAGATGAGAAGGG - Intronic
943520939 2:188948878-188948900 AAGTGTCCAGAGGATTAGAATGG - Intergenic
943631858 2:190262585-190262607 AAGATTCCAGAAGATGTGATGGG - Intronic
943769881 2:191705033-191705055 AAGGATCCAGAAAAAGAACAGGG - Intergenic
945240764 2:207674892-207674914 ATGGAAGCAGAAGATGGGAAAGG - Intergenic
947806883 2:232975335-232975357 AAAGTCTCAGAAGATGAGAAAGG + Intronic
948299068 2:236888435-236888457 GAGGAACCACAAGGTGAGAAGGG + Intergenic
948517330 2:238511904-238511926 GTGTATCCAGAAGGTGAGAATGG + Intergenic
948745204 2:240086599-240086621 AATGATCCAGAAGATTAGGGGGG + Intergenic
1169085297 20:2822336-2822358 AACAAGCCACAAGATGAGAAGGG - Intergenic
1169530617 20:6481254-6481276 GAGGTTCCACAAGATGAGGAAGG + Intergenic
1169887273 20:10414053-10414075 AAACGTCCAGAAAATGAGAAAGG + Intronic
1170368631 20:15624182-15624204 AAGCATGCAGCAGAGGAGAAAGG + Intronic
1170471204 20:16669955-16669977 TAGGATGCAGAAGCTGAGGAGGG + Intergenic
1171173661 20:23035680-23035702 AAGGATCACGAAGATGACCAGGG - Exonic
1172206148 20:33164260-33164282 GAGGATCTGGAAGATGAGAGAGG + Intronic
1172651791 20:36508179-36508201 AAGGTTTCAGAAGAGGAGGAGGG + Intronic
1173115398 20:40237006-40237028 AAGGATCCAGAGCATGAAAACGG + Intergenic
1174860731 20:54088690-54088712 AAAATTCCAGAAGATGAGCAAGG - Intergenic
1176027793 20:62994816-62994838 AACGAACCAGCAAATGAGAAAGG - Intergenic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1177030039 21:15971025-15971047 AAGCATCCAGCACAGGAGAAAGG - Intergenic
1177085046 21:16693329-16693351 AATTATGCAGAAGATGATAATGG - Intergenic
1177225773 21:18253493-18253515 AAGGATGTAGTAGATGAAAATGG + Intronic
1178112728 21:29385227-29385249 AATGATCCAGTAGATGATAAGGG - Intronic
1178296622 21:31415672-31415694 AAGGGTGTAGAAGCTGAGAATGG - Intronic
1180241513 21:46510203-46510225 AAGCATCCAGCACAGGAGAAAGG + Intronic
1180338468 22:11599801-11599823 AAGGATCAAGAAACAGAGAAAGG - Intergenic
1181291334 22:21795971-21795993 TAGGATACAGAGGAAGAGAAAGG + Intronic
1182179475 22:28331181-28331203 AAGGCTCCTGAAGCTGATAAAGG + Intronic
1182505816 22:30781580-30781602 AAAGATCCAGGGGATGTGAATGG + Intronic
1183383156 22:37500520-37500542 CAGGCTCCAGGAGCTGAGAAGGG + Intronic
1184480018 22:44740913-44740935 AAGACTCCAGAAGAAGAGAGAGG + Intronic
1184725431 22:46342316-46342338 AAGGATACAGATGAAGAGACGGG + Intronic
949455557 3:4234726-4234748 TCAGATGCAGAAGATGAGAATGG + Intronic
949941119 3:9155494-9155516 AGAGTTCCAGAAGAAGAGAATGG - Intronic
951056837 3:18157088-18157110 AATGATACAGAAGATTATAATGG + Intronic
951086868 3:18521864-18521886 AAGCATCCAGCACAGGAGAAAGG - Intergenic
951507341 3:23462714-23462736 AGGGATGCAAAAGATGAGACGGG - Intronic
953081357 3:39621753-39621775 AATAATACAAAAGATGAGAATGG + Intergenic
953262996 3:41358447-41358469 AAGGATGCAGAGGCAGAGAAAGG + Intronic
953458467 3:43062695-43062717 AAGGATCCTGAAGTCCAGAAAGG + Intergenic
953688891 3:45100558-45100580 ACTGATCCAGCAGATGTGAAAGG - Intronic
955379872 3:58429318-58429340 AAAGATCCAGAACCTCAGAAGGG + Intronic
956206615 3:66761664-66761686 ACGGAGCAAGAAGAGGAGAATGG - Intergenic
956980601 3:74632946-74632968 AAGAATCCAGACTAAGAGAAAGG - Intergenic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957380714 3:79425387-79425409 CAGGATTCAGAAGATCAGAGAGG - Intronic
959836776 3:110927099-110927121 GTGGATACAGAAGATGAGACTGG + Intergenic
960209621 3:114945808-114945830 AAGTATACAGAAAATGTGAAAGG + Intronic
962075682 3:132079736-132079758 CAGGATACAGAAGATAAGACTGG - Intronic
962164124 3:133031373-133031395 AAGGAACCCTAAGTTGAGAAAGG + Intergenic
963128038 3:141833310-141833332 AAGGCTCTAGAAGTTGAAAATGG + Intergenic
963985114 3:151583998-151584020 AAGCATCCAGAAAATTAGTAAGG - Intergenic
964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG + Intergenic
964730612 3:159860810-159860832 GGGGATCCAGTAGATGAGAAAGG - Intronic
965467204 3:169044845-169044867 AAAGATGCAGGAGATGAGGAGGG + Intergenic
965777925 3:172253228-172253250 AAGGAGCCGAAAGATGATAAGGG + Intronic
965925962 3:173979993-173980015 TTCAATCCAGAAGATGAGAATGG - Intronic
966391624 3:179458812-179458834 AAGGATGCAGAAGATATGGAAGG + Intergenic
967403165 3:189086194-189086216 AAGCATCCAGCACAGGAGAAAGG + Intronic
969829342 4:9782172-9782194 CAGGGTCCAGATGATGAGTAGGG - Exonic
969897581 4:10319650-10319672 CAGGATGCAGAAAGTGAGAAAGG + Intergenic
971150507 4:24026427-24026449 AAGGAAGCTGAAGATGAGACAGG - Intergenic
971353790 4:25876277-25876299 AAGGGTCAAGAAGCTCAGAAGGG - Intronic
971394039 4:26212396-26212418 AAGGCAGGAGAAGATGAGAAAGG - Intronic
971664124 4:29459803-29459825 AAGCATCCAGCACAGGAGAAAGG - Intergenic
971790751 4:31167364-31167386 AAGCATCCAGCACAGGAGAAAGG + Intergenic
972148955 4:36064887-36064909 AAGGGTGGAGATGATGAGAAAGG + Intronic
972794867 4:42405343-42405365 AAGAATCCAGAAGAAGAGTGAGG + Intergenic
973946592 4:55962805-55962827 AAAGATACATAAGACGAGAAGGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974369794 4:61000729-61000751 AAAGTTCCAGAAGAAGAGAGAGG + Intergenic
974784046 4:66594302-66594324 AATGATGAAGAAGATTAGAATGG + Intergenic
976613845 4:87056124-87056146 AGGGATTAAGAAGATTAGAATGG - Intronic
977464610 4:97368109-97368131 AGAGATCCAGCAGAAGAGAAAGG - Intronic
977609463 4:99017310-99017332 AAATATCCAGAAAATGAGATAGG - Intronic
978309358 4:107369100-107369122 AAGGATTCTGAAGATTAGAGAGG - Intergenic
978499255 4:109391401-109391423 AAGGAACCTGAAGTTCAGAATGG + Intergenic
978690112 4:111497800-111497822 AAAGATTCATTAGATGAGAATGG - Intergenic
978792333 4:112675805-112675827 AAGGATGCAGATGGTGATAATGG - Intergenic
979980708 4:127251502-127251524 AAGGTCCCATAAGAGGAGAAAGG + Intergenic
980957286 4:139442629-139442651 AAGCATCCAGCATAGGAGAAAGG - Intergenic
981399054 4:144290571-144290593 AAGGACCTAGAGGATGAGGAGGG + Intergenic
981551964 4:145951157-145951179 AAGGATGCAGGAAAGGAGAATGG - Intergenic
983404339 4:167307839-167307861 AATGATCCAGAGGCTGAGTAAGG - Intergenic
983596802 4:169477291-169477313 AAAGCTCAAGAAGATGAAAAAGG - Exonic
985317838 4:188677250-188677272 AAGGATCAATATGATGAAAACGG + Intergenic
985377823 4:189360579-189360601 AAGGAAACAGGAGATGAGAAGGG + Intergenic
987781010 5:22435239-22435261 AAGCATCCAGTACAGGAGAAAGG - Intronic
988335272 5:29899659-29899681 AAGCATCCAGCACAGGAGAAAGG - Intergenic
988434991 5:31163828-31163850 AACAATCCAGGAAATGAGAAAGG + Intergenic
988714483 5:33811558-33811580 AAGGAACCAGAGGACCAGAATGG + Intronic
988818454 5:34857181-34857203 AGTGATCCAGCAGCTGAGAAAGG + Intronic
989257218 5:39378777-39378799 AAGGAAGCAGAACAGGAGAATGG - Intronic
991287337 5:64992504-64992526 AAGTATTCCAAAGATGAGAATGG - Intronic
992203492 5:74406922-74406944 AGGGATCCAGAAGCAGAGAAAGG + Intergenic
992589061 5:78274627-78274649 AAGCATCCAGAGGCTGAGCATGG + Intronic
993296786 5:86150595-86150617 AATAATATAGAAGATGAGAATGG - Intergenic
993382653 5:87225222-87225244 AAGGCTCTAGAAGATGGAAAAGG + Intergenic
993507389 5:88726741-88726763 GAGGTTTCAGAAAATGAGAAAGG - Intronic
994242524 5:97441673-97441695 AAAGATCAATAAAATGAGAATGG - Intergenic
996651125 5:125878004-125878026 AAGGCTCCAGAAGAAAAGGAAGG + Intergenic
997955393 5:138274810-138274832 TGGGATCCAGAAAGTGAGAAAGG - Intergenic
998939758 5:147268653-147268675 AGGCTTCCAGAACATGAGAATGG - Intronic
999254691 5:150203733-150203755 AAGCATGAAGAAGAAGAGAAAGG - Exonic
999602244 5:153280166-153280188 AAGGAAACAGAAGATCAGGAAGG - Intergenic
999871839 5:155759745-155759767 ATGGATGCAGAAGAAAAGAAAGG - Intergenic
999994049 5:157075038-157075060 TAGAAACCAAAAGATGAGAAAGG + Intergenic
1000495768 5:161982478-161982500 AAGGAACCAGAATATAAAAATGG + Intergenic
1001149702 5:169216470-169216492 AAAAATCCAAGAGATGAGAAAGG + Intronic
1001279078 5:170373060-170373082 AAGGATTTGGGAGATGAGAAAGG - Intronic
1001717392 5:173827717-173827739 TAGGATACAGAAGGTGGGAAAGG + Intergenic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1001977515 5:176012263-176012285 AAGGTTCTAGAAGAAAAGAAAGG + Intronic
1002271277 5:178074189-178074211 AATGATACAGAAGAGGGGAAAGG + Intergenic
1002762912 6:215650-215672 AAGTAGCCAGAAGGTGTGAAAGG + Intergenic
1003321169 6:5053322-5053344 CAGGATCCAGAAAATGGAAATGG + Intergenic
1003407007 6:5834144-5834166 AGGGAGCAAGAAAATGAGAAGGG + Intergenic
1003717439 6:8663860-8663882 AAGGATAGAGAATATTAGAAAGG + Intergenic
1004182953 6:13396660-13396682 AAGGAAGCAGGAGATCAGAATGG + Intronic
1004316447 6:14592319-14592341 AAGCATCCAGCACAGGAGAAAGG - Intergenic
1004708489 6:18147539-18147561 AAGGATCCAGGAAATGTAAAAGG + Intronic
1005087768 6:22024452-22024474 AAGGATGCAGAAGATGGGAAAGG - Intergenic
1007053441 6:38857003-38857025 AGGGAGACAGAAAATGAGAAGGG - Intronic
1007718597 6:43871807-43871829 AAGGATCTAGAAGAAAAAAATGG + Intergenic
1007956360 6:45921250-45921272 AAGGTTTTAGAAGATGGGAAGGG + Intronic
1008139076 6:47811013-47811035 AACGAACCAGAGGCTGAGAAAGG + Intronic
1010012894 6:71069774-71069796 AAAGATTGAAAAGATGAGAAAGG - Intergenic
1010289302 6:74116677-74116699 AAGGATCCTGAAGCTGAGGGAGG - Intergenic
1012681584 6:102189465-102189487 AAGCATCCAGATGATGATGATGG + Intergenic
1013184074 6:107742393-107742415 AACTTTCCAAAAGATGAGAAGGG + Intronic
1013434804 6:110092538-110092560 AAGTCTCCAGAAGATGATATAGG + Intergenic
1014302306 6:119697013-119697035 AAGCATTCAGAAGAGGATAATGG + Intergenic
1015190653 6:130468170-130468192 AAGGATCCAGAAGAGCCTAAGGG + Intergenic
1015242044 6:131035432-131035454 AAGGAAGCAGAAGAGGAGATGGG - Intronic
1015274606 6:131371288-131371310 AAGGCACCAGAAGCTGAGAAAGG + Intergenic
1015373119 6:132478803-132478825 AAGGACAGAGAACATGAGAAAGG + Intronic
1015473194 6:133629799-133629821 ATGGTTCCAGAAGATGTGTATGG + Intergenic
1016088298 6:139943260-139943282 AAAGATTCAGAATATGATAAAGG - Intergenic
1016216449 6:141609161-141609183 TAGGATCCAGAAAATGGAAAAGG - Intergenic
1016420416 6:143876776-143876798 AAGCATCCAGCACAGGAGAAAGG + Intronic
1017134241 6:151134266-151134288 AGGGTTCCAGAAGAAGGGAATGG + Intergenic
1017217691 6:151929305-151929327 AAGGATAAAGATGATGATAAAGG - Intronic
1017427094 6:154333394-154333416 AAGCATCCAGCATAGGAGAAAGG - Intronic
1017468608 6:154717926-154717948 AATGCTCCAGAAGCTGAGAAAGG + Intergenic
1017606975 6:156145134-156145156 AAGGATCAAGAGGCTGAGACTGG + Intergenic
1017642908 6:156511630-156511652 AAGGACCCTGCAGATGAGGAGGG + Intergenic
1017874864 6:158516181-158516203 AAAGATCCAGAAGAGGTAAAAGG - Intergenic
1018043647 6:159946910-159946932 AAGGATGGAGAAGATTAGAGAGG + Intergenic
1019075769 6:169387116-169387138 AAGGAGCCAGGGGCTGAGAACGG + Intergenic
1019221312 6:170475003-170475025 AAGGATACAGATGAAGAGACAGG - Intergenic
1021077702 7:16325198-16325220 AAGAATTCACAAGTTGAGAAAGG + Intronic
1021233789 7:18117827-18117849 AGGAATTCAGAAGTTGAGAATGG + Intronic
1021819229 7:24479857-24479879 ATGGATGCAGGAGATTAGAAGGG - Intergenic
1021868878 7:24983866-24983888 AAGGAGGAAGAAGATGAGTAGGG - Intergenic
1022655802 7:32318549-32318571 AGGGACCCAGAAGAAGTGAAAGG + Intergenic
1023165196 7:37336666-37336688 GAGTTTCAAGAAGATGAGAATGG + Intronic
1023494838 7:40784062-40784084 AAAGATCCAGAAGCTGTAAAAGG - Intronic
1024304670 7:47918027-47918049 AAGGATACAGAATAGCAGAATGG + Intronic
1025090798 7:56062452-56062474 ATGTATCCAGAAGAAGAGAGGGG + Intronic
1027276303 7:76560340-76560362 AATGGTCCAGAAGATCAGAGAGG - Intergenic
1027973140 7:85112988-85113010 AAAACTCCAGAAGATGAGATAGG - Intronic
1028449553 7:90965882-90965904 AATGATCGAGAAGTGGAGAATGG - Intronic
1028480580 7:91300396-91300418 GAGGATTCAGAAGATAATAAAGG - Intergenic
1028924216 7:96339982-96340004 AGAGAGCCAGGAGATGAGAATGG - Intergenic
1028984275 7:96997648-96997670 AAGGAGCGAGAAAATGAAAAGGG + Intergenic
1029094045 7:98071191-98071213 AAGGATTAAGAAGATGGGATAGG - Intergenic
1029607415 7:101607290-101607312 AAGCATCCAGCACAGGAGAAGGG - Intergenic
1030307620 7:108035096-108035118 AAGGCTCCTGAAGGTTAGAAAGG - Intronic
1030735443 7:113042638-113042660 AAGGATCAAGAAAAACAGAATGG + Intergenic
1031642455 7:124181178-124181200 AATGATACAGAAGAGGGGAAGGG - Intergenic
1033557444 7:142500988-142501010 CAGGATGCAGAAGATGATGATGG - Intergenic
1033766576 7:144499416-144499438 AAGTAACCAAAAGATGTGAAAGG - Intronic
1034030666 7:147759602-147759624 AAGGATGCAGATGATGATAAAGG + Intronic
1034110946 7:148537091-148537113 CCTGACCCAGAAGATGAGAATGG - Intergenic
1034607301 7:152329262-152329284 ATGGTTCAAGAAGATGAGAGAGG + Intronic
1034875887 7:154724530-154724552 AAGTCTCCTGAAGATGAGTATGG - Intronic
1035682328 8:1497039-1497061 CAAGCTCCAGCAGATGAGAAAGG + Intergenic
1035932435 8:3796685-3796707 AAGGTTAGAAAAGATGAGAATGG + Intronic
1037020780 8:13967598-13967620 GGGGATCCAGAGGATGACAAGGG - Intergenic
1037433295 8:18837037-18837059 AAATATCCAGAAGGAGAGAAAGG + Intronic
1037513819 8:19610309-19610331 AAAGATACAGAAGAGGGGAAGGG + Intronic
1038164931 8:25076730-25076752 ATGAAACCTGAAGATGAGAATGG - Intergenic
1039081162 8:33735327-33735349 AAGGATCAAGAATATGACAGAGG + Intergenic
1039719611 8:40149282-40149304 AAGGAGTCAGAAGGTCAGAAAGG - Intergenic
1041839671 8:62254466-62254488 AAGGATACAGAAGAAGAGGTTGG + Intronic
1042821447 8:72934418-72934440 AAGGAGACATAAGAGGAGAAAGG + Intronic
1042823030 8:72952546-72952568 AAGGAATCAGGAGATGAGCACGG - Intergenic
1044031989 8:87249799-87249821 AATCATCCAGTAGATTAGAAAGG + Intronic
1044122541 8:88415440-88415462 GAGCAGCCAGAAGATGAGACAGG - Intergenic
1044422202 8:92010007-92010029 AAGTATCCAGAAGCCTAGAAAGG - Intronic
1044554102 8:93543410-93543432 GAGAATACACAAGATGAGAATGG + Intergenic
1045648053 8:104318344-104318366 AAGGATTCTGAAGCTCAGAAAGG + Intergenic
1046724251 8:117657099-117657121 AAAGATGCAGAAGTTTAGAAGGG - Intergenic
1048187170 8:132251957-132251979 AAGGATCCAGAAGATGAGAAAGG - Intronic
1048893038 8:138964851-138964873 AGGGAGCCAGCAGATGTGAATGG - Intergenic
1049913842 9:297114-297136 AAGGAGAAAGAAGATGTGAAAGG + Intronic
1050108338 9:2189036-2189058 AAGGATGCAGATGATTAGACTGG + Intronic
1050784889 9:9388377-9388399 AATGATACAGAAGAGGGGAAGGG - Intronic
1052003313 9:23315133-23315155 AAGCATCCAGCACAGGAGAAAGG - Intergenic
1052626272 9:30980990-30981012 AAAGATCCATAGGATGAGCATGG - Intergenic
1052713794 9:32090169-32090191 GAGGATCCAAAAGATTATAATGG + Intergenic
1053275909 9:36783201-36783223 AGGGATCCAAAAGCAGAGAATGG - Intergenic
1055281290 9:74677230-74677252 AAGGCTCAGGAAGACGAGAAAGG + Intronic
1055534616 9:77226505-77226527 AAAGATCCAGAGGATAATAAAGG + Exonic
1056278256 9:85014221-85014243 ATGGATACAGTAGAAGAGAAGGG + Intronic
1056319505 9:85423105-85423127 TAGGACCCACAAGCTGAGAATGG - Intergenic
1057138220 9:92710123-92710145 AAGGACCCAGAAGATGAGGATGG + Intergenic
1057442462 9:95091966-95091988 ATAGATCCAGAAGAGAAGAAAGG + Intergenic
1057536843 9:95918411-95918433 AAGGAACAAGAAAACGAGAAGGG + Intronic
1057972025 9:99567665-99567687 CAGGATCCAGATGATTAGAGTGG + Intergenic
1059494305 9:114696987-114697009 CAGGACTCAGAAGATGTGAAGGG + Intergenic
1060153495 9:121303257-121303279 AAGGAACCAGAGGCTCAGAAAGG - Intronic
1060288718 9:122279988-122280010 AAGTAAACAGAAGATGAGAAAGG - Intronic
1060531446 9:124349288-124349310 CCGAATTCAGAAGATGAGAAAGG - Intronic
1061256183 9:129455071-129455093 GAGGAGGCAGAAGGTGAGAAAGG - Intergenic
1061386317 9:130291968-130291990 AAGAATCCAGAACATGGGACAGG - Intronic
1185939561 X:4300508-4300530 CAGGTACCAGAGGATGAGAAGGG - Intergenic
1186553477 X:10532138-10532160 AAGGATTCAGAAGTTGAACAAGG - Intronic
1187492256 X:19762974-19762996 AAGGATACAGAAATTTAGAAAGG - Intronic
1187752010 X:22477165-22477187 AAAGATACAGAAGAGAAGAATGG - Intergenic
1188288484 X:28359348-28359370 AAAGAGACAGAAGGTGAGAAAGG - Intergenic
1188405659 X:29806087-29806109 AAGGAACCAGAAAATGGGAGGGG + Intronic
1189046921 X:37603199-37603221 CAGGATCTAAAAGATGAGCAGGG + Intronic
1189467893 X:41291413-41291435 CAGGATCCAGAATGTGAGAGGGG - Intergenic
1189609227 X:42714299-42714321 AAGAACCCAAAAGATGAGTAGGG + Intergenic
1190491116 X:50983470-50983492 AAGAAGACAGAAGAGGAGAAAGG - Intergenic
1191719702 X:64219258-64219280 AAGCATCCAGCACAGGAGAATGG + Intergenic
1191722961 X:64249840-64249862 AAATTTCCAGAAGAAGAGAAAGG - Intergenic
1192317862 X:70066326-70066348 TAGGAGCCAAAGGATGAGAAAGG + Intergenic
1192507461 X:71697691-71697713 AAGAATTCAGAAGATTTGAAGGG + Intergenic
1192519235 X:71783861-71783883 AAGAATTCAGAAGATTTGAAGGG - Intergenic
1195782807 X:108483386-108483408 AAGCATCCAGGATAGGAGAAAGG + Intronic
1195933161 X:110099886-110099908 AAGGATCCATATGCTGAGAATGG - Intronic
1196188013 X:112764912-112764934 AAGGTGCCTGAGGATGAGAAGGG + Intergenic
1196423161 X:115543454-115543476 AAGTATCCTGAAGAAAAGAAAGG - Intergenic
1197012385 X:121581859-121581881 AAGGATCAAGCAAAAGAGAAAGG - Intergenic
1198370069 X:135981636-135981658 AAGGAACTAGAAGTTCAGAATGG + Intergenic
1198736590 X:139792317-139792339 AAGGATACAGATGAAGAGATGGG - Intronic
1198994018 X:142552423-142552445 AAGGAGCCAGAAGATATGAAAGG + Intergenic
1200002437 X:153068947-153068969 AAGGACCACGGAGATGAGAAGGG + Intergenic
1200005287 X:153081063-153081085 AAGGACCACGGAGATGAGAAGGG - Intergenic
1201195066 Y:11485264-11485286 AAGGAGAGAGAAGAAGAGAAAGG + Intergenic
1201412442 Y:13713592-13713614 AATGATGCAGAAGAGGGGAAGGG - Intergenic
1201950130 Y:19554730-19554752 GAGGTTTCAGAGGATGAGAAAGG - Intergenic