ID: 1048188064

View in Genome Browser
Species Human (GRCh38)
Location 8:132262671-132262693
Sequence ATGGAGACATGAGCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048188060_1048188064 -4 Left 1048188060 8:132262652-132262674 CCATGATATACTCTTGAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1048188064 8:132262671-132262693 ATGGAGACATGAGCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048188064 Original CRISPR ATGGAGACATGAGCTGAGGA GGG Intronic
No off target data available for this crispr