ID: 1048190314

View in Genome Browser
Species Human (GRCh38)
Location 8:132282411-132282433
Sequence CAAGGGGGACAGATGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048190314 Original CRISPR CAAGGGGGACAGATGGGACT GGG (reversed) Intronic
901737739 1:11323053-11323075 CAAGGGAGACACATGAGATTTGG - Intergenic
903013485 1:20346859-20346881 AAAGGGGGACAGGTGGAATTAGG - Intronic
903738722 1:25545704-25545726 CACGAGGGACAGGTGGGGCTCGG - Intronic
903953628 1:27010863-27010885 CCAAGGGCACAGATGTGACTAGG - Intronic
904011974 1:27395069-27395091 GAAGAGGGACATCTGGGACTTGG - Exonic
905196772 1:36285876-36285898 CAAGGGGGAGAGAGCTGACTAGG + Intronic
905517953 1:38576120-38576142 CAAGGGGTAGAGCTGGGATTTGG + Intergenic
905615180 1:39392089-39392111 CAAGGTGGACAGGTGGAACAGGG - Intronic
905631483 1:39521468-39521490 CGAGGGGTGCGGATGGGACTCGG - Exonic
905666271 1:39764703-39764725 CGAGGGGTGCGGATGGGACTCGG + Exonic
905874187 1:41422014-41422036 GAAGGGGGATAGATGGGAGGAGG + Intergenic
906755594 1:48311826-48311848 AAAGGGTGACAGATGGTACCTGG + Intronic
907326976 1:53644651-53644673 CAGAGGGAACAGATGGGACCAGG + Intronic
908264989 1:62369479-62369501 TAAGGGGGACAGATGAGTTTTGG - Intergenic
910599968 1:89020485-89020507 GTTGGGGGACAGAAGGGACTTGG + Intronic
911598212 1:99820770-99820792 AAAGGGGGACAGGAAGGACTTGG - Intergenic
912614594 1:111085478-111085500 CAAGGGGGACAGGGGGAACATGG + Intergenic
920128963 1:203716135-203716157 CTAGGAGGACTCATGGGACTTGG + Intronic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
1064121320 10:12622476-12622498 CCAGGTGGAGAGATGGGATTAGG - Intronic
1065452901 10:25877390-25877412 CAAGGTGGACAGAGTGGACTTGG + Intergenic
1066467754 10:35668261-35668283 CGTGGGGGAGAAATGGGACTCGG - Intergenic
1067063954 10:43093303-43093325 CAGGGGTGGCAGAGGGGACTTGG + Intronic
1067187752 10:44044649-44044671 CAAGGGGGACAGCAGGGCCCTGG + Intergenic
1070724468 10:78778783-78778805 CCAGGAGGACAGATGGGAGCTGG + Intergenic
1071102104 10:82050756-82050778 CAAGGGGTAGAGATGGGAGGAGG - Intronic
1071479777 10:86056523-86056545 GAATGGGGACAGGTGGGAGTAGG - Intronic
1071506696 10:86236710-86236732 CAAAGGGGACAGGTGTGAGTAGG + Intronic
1072037266 10:91574972-91574994 CACGGAGGAGTGATGGGACTGGG - Intergenic
1073489919 10:103846299-103846321 CAGCAGGGAGAGATGGGACTGGG + Intronic
1074141895 10:110680491-110680513 CCAGGAGAACAGATGAGACTTGG - Intronic
1074577963 10:114688694-114688716 CAAGGAGTACAGTTGGGATTTGG + Intergenic
1075023446 10:118967496-118967518 GAAGGGGGAGAGATGGGGGTGGG - Intergenic
1075479645 10:122768951-122768973 CCAGGGGGACAGATTGGTGTGGG - Intergenic
1075817864 10:125279696-125279718 CAGGGGGAACAGATGAGAATGGG - Intergenic
1076795405 10:132795608-132795630 CAGGGGGGACTGATGGGGCGGGG + Intergenic
1077771305 11:5221863-5221885 AAAGGGTGACAGATGGCACCTGG - Intergenic
1078111400 11:8396720-8396742 AAGGGGTGACAGATGGCACTTGG + Intronic
1078454038 11:11461216-11461238 CAAGGGGGACTTCTGGGCCTGGG + Intronic
1078663156 11:13303427-13303449 CAAGGAGGTCAGATGGGAAGTGG + Intronic
1078884889 11:15490205-15490227 GAAGAGGGACAGGTGGGAGTAGG + Intergenic
1081970356 11:47194143-47194165 CAAGGCAGACCGATGGCACTCGG + Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083523067 11:63334013-63334035 CAGGGGTGACAGATGGCACCTGG - Intronic
1083594312 11:63911772-63911794 CACTGAGGACAGAAGGGACTAGG - Exonic
1083855159 11:65389636-65389658 CCATGGGGAAAGGTGGGACTTGG + Intronic
1084717075 11:70880771-70880793 CAAGGAGGACTGAAGGGGCTAGG + Intronic
1084870078 11:72092644-72092666 CAAGGGGGACAGAGAGGAAAAGG - Intronic
1087397936 11:97626130-97626152 CAAAGGGGACACCTGGGATTTGG + Intergenic
1088607017 11:111541690-111541712 CAAACGGGACAGAGGAGACTGGG + Intronic
1088727970 11:112656281-112656303 CAAGGAGGATAGATGGGAGAGGG - Intergenic
1089303709 11:117514037-117514059 CAAGAGGGACATATGGGAAGAGG - Intronic
1091541415 12:1465926-1465948 CAAGTAGGAAAGATGGGACCAGG + Intronic
1091730166 12:2874735-2874757 CAAAGGGCAAAAATGGGACTGGG + Intronic
1092217400 12:6693026-6693048 GAGGGGGGATAGATGGGACCTGG + Intergenic
1094355707 12:29575112-29575134 CAAGTGGTAGGGATGGGACTTGG + Intronic
1094552405 12:31465159-31465181 CAAGGGCAACAGAGGGGTCTAGG + Intronic
1095159639 12:38901788-38901810 CAAAGGGGAGAGATGGGGCTTGG - Intronic
1096839305 12:54370804-54370826 CCAGGGGGCCAGATGGGAGGGGG - Intronic
1097167883 12:57095237-57095259 CTTGGGGGATAGATGGGAATGGG - Exonic
1098642654 12:72857310-72857332 CAGGGGTGACAGATGGCACCTGG - Intergenic
1100673298 12:96839536-96839558 TAACAGGGACAGATGGGAATGGG - Intronic
1101125491 12:101629485-101629507 CAAGATGGACAGCTGGGAGTTGG - Exonic
1101540563 12:105661058-105661080 CAGTGAGGACAGAAGGGACTAGG - Intergenic
1103443691 12:120980581-120980603 CCAGGGCCCCAGATGGGACTGGG + Intronic
1103744691 12:123114527-123114549 CAAAGGGGAGAAATGGCACTTGG - Intronic
1104463021 12:128970332-128970354 GAAGTGGGACAGATGGGAAGTGG - Intronic
1104917826 12:132275124-132275146 CACGGGGGAAAGAAGGGACATGG - Intronic
1105299062 13:19117100-19117122 CACGGGGGACAGTGGGGACAGGG - Intergenic
1107227189 13:38065616-38065638 AAGGGGTGACAGATGGCACTTGG + Intergenic
1108553212 13:51567269-51567291 AAGGGGTGACAGATGGCACTTGG + Intergenic
1109106892 13:58264317-58264339 CAGGAGGCATAGATGGGACTGGG - Intergenic
1110152458 13:72271360-72271382 CAGGGGTGACAGATGGCACCTGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1114200494 14:20515516-20515538 CAAAGGGGAGAAATGGGACCCGG - Intergenic
1116546100 14:46167018-46167040 AAAGGGTGACAGATGGTACCTGG - Intergenic
1118053192 14:62051354-62051376 AAAGGGTGACAGATGGCACCTGG - Intronic
1118077612 14:62318006-62318028 AAAGGAGGTCAGATGAGACTGGG - Intergenic
1118105878 14:62658851-62658873 AAAAGTTGACAGATGGGACTTGG + Intergenic
1118704473 14:68468182-68468204 GAAGGGAGCCAGAGGGGACTTGG - Exonic
1119649286 14:76372254-76372276 CATGGGGGACAGAGTGGGCTAGG + Intronic
1121893978 14:97628196-97628218 TAAAGGGGAAAGATGGTACTTGG + Intergenic
1122612450 14:102994821-102994843 CAAGGGGAACGGATGGAAGTGGG - Intronic
1122968909 14:105144518-105144540 CAAGGGGGTCGGGTGAGACTGGG - Intronic
1123486384 15:20743423-20743445 CAAGGTGGACAGATGAGATCAGG - Intergenic
1123542872 15:21312473-21312495 CAAGGTGGACAGATGAGATCAGG - Intergenic
1124115530 15:26839227-26839249 CAAGGAAGAGAGATGGGGCTTGG + Intronic
1125440330 15:39695288-39695310 CACGGGGTACAGATGGGGATTGG - Intronic
1125755047 15:42057888-42057910 GAAGGGGGACAGAGGAGACAAGG - Intergenic
1126811389 15:52409213-52409235 CAGGGGGGAAAGATGGTCCTTGG - Intronic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1127156053 15:56125857-56125879 CAGGGGAGAAAGATTGGACTTGG - Intronic
1131510901 15:93048928-93048950 CCAGGGAGACTGATGGCACTTGG - Intronic
1202951191 15_KI270727v1_random:39603-39625 CAAGGTGGACAGATGAGATCAGG - Intergenic
1132693589 16:1192469-1192491 CAATGGGGACAGAAGGGAAGGGG - Intronic
1133054627 16:3139413-3139435 GAAGGGACACAGCTGGGACTTGG + Intronic
1133606676 16:7394375-7394397 CTAAGGAGACAGAAGGGACTGGG - Intronic
1133970324 16:10563143-10563165 CAAGAGTGACTGATGGGCCTGGG - Intronic
1134411319 16:14004881-14004903 CCAGGTGGACAGATGGGAGCTGG - Intergenic
1136376899 16:29871257-29871279 CAAAGGGGAGAGCTGGGACAAGG - Exonic
1137224484 16:46490098-46490120 AAAGGGTGACAGATGGCACCTGG + Intergenic
1137390609 16:48078317-48078339 CTTGGGGGACAGATGAGAATCGG + Intergenic
1139530124 16:67538580-67538602 AAAGGGCGTCAGATGGGGCTGGG + Intronic
1143171359 17:4932456-4932478 CAAGGGTGGGAGATGGGAGTAGG + Intronic
1143360989 17:6371124-6371146 CGAGGGGGACAGAGGAGAATGGG + Intergenic
1143388683 17:6547428-6547450 TAGGGGGGACAGCTGGGCCTTGG - Intronic
1143594509 17:7906371-7906393 GCAGGGGGACAGTTAGGACTTGG + Intronic
1144120479 17:12147826-12147848 AAAGGGGAAAAGATGGGAGTAGG + Intergenic
1146186411 17:30727342-30727364 CAAAGGGGCCAGAGGGCACTTGG + Intergenic
1147338699 17:39741377-39741399 CAAGGGGGAGAGCAGGGCCTGGG - Intronic
1147760561 17:42795234-42795256 TGAGGGGGACAGCAGGGACTGGG - Exonic
1148002462 17:44397829-44397851 AATGGGGGTCAGATGGGGCTGGG + Exonic
1148441553 17:47714181-47714203 GCAGAGGGAGAGATGGGACTGGG - Intergenic
1149626083 17:58082171-58082193 GAAGGGGAAAAGATGGGAGTGGG + Intergenic
1150283809 17:63944512-63944534 CAAGGTGGCCTGGTGGGACTGGG + Intronic
1150875625 17:68967170-68967192 CAAGGGGGAAAGGTGGGAAGGGG - Intergenic
1151144995 17:72032180-72032202 CAAAGGGAAGAGATGGAACTGGG - Intergenic
1152104227 17:78319371-78319393 CAGGGAGGAGAGAAGGGACTAGG - Intergenic
1152317854 17:79591216-79591238 CAGGGGGGACACATGGCAATGGG - Intergenic
1152599131 17:81252693-81252715 CACGGGGGACAGATGGGGTCAGG + Intronic
1152781308 17:82228534-82228556 GAAGGGGGACAGGTCGGACGTGG + Intronic
1153541811 18:6163938-6163960 AAAGGGTGACAGATGGCACCTGG + Intronic
1155313458 18:24547543-24547565 TAAGGGGGACAATTGGGACGTGG + Intergenic
1156900135 18:42290823-42290845 ACTGGGGGACAGATGAGACTGGG + Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1159453217 18:68628746-68628768 CAAGGCGGGCAGATGAGTCTAGG - Intergenic
1162875308 19:13616908-13616930 TAAGGGGAACAGATGGTACAGGG + Intronic
1163696767 19:18768274-18768296 CAAGGGGGTCAGCTGGAGCTGGG - Intronic
1163729788 19:18942115-18942137 CAAGTGGGACACATGGGCTTGGG - Intergenic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1165773088 19:38389534-38389556 CAGGGGGGAAAGATGGGATGGGG - Intronic
1166398892 19:42463283-42463305 GAAGGGGGAGAGGTGAGACTAGG + Intergenic
1166732421 19:45066738-45066760 CTTGGGGGACAGGTGGGACCTGG + Intronic
1168417889 19:56180825-56180847 CAAGGGGCAGAGCTGGGATTTGG - Intronic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925650564 2:6085309-6085331 CAAGGGGAACAGACAGGACCTGG - Intergenic
927313583 2:21656824-21656846 CAATTGTGACAGAAGGGACTCGG + Intergenic
927934056 2:27065313-27065335 CCAGGGGGACAGATGGTAAATGG - Intronic
929244609 2:39687547-39687569 AAAGGGGCACAGAAGTGACTAGG - Intronic
932207688 2:69897992-69898014 CATGGAGGACAGATGGGAGGTGG + Intronic
935402985 2:102679886-102679908 CAAGAGGGAGAGAAGGGAATGGG + Intronic
935541498 2:104354122-104354144 CATGTGGCATAGATGGGACTTGG + Intergenic
937047499 2:118859433-118859455 CAAGGTGGAACCATGGGACTGGG - Intergenic
937152428 2:119695204-119695226 GAATGTGGACAAATGGGACTGGG + Intergenic
941236369 2:162979921-162979943 GAAGGGGGGTAGATTGGACTAGG - Intergenic
945481498 2:210350866-210350888 AAAGGGTGACAGATGGCACCTGG + Intergenic
947317876 2:228881574-228881596 CTAGGGAAACTGATGGGACTTGG + Intronic
947791892 2:232873361-232873383 CACGGGGGACAGATGGGGACAGG + Intronic
948817435 2:240519663-240519685 CCAGGGGGACAGGTGGGAAAAGG + Intronic
1170572801 20:17641945-17641967 CAGAGGGGACAAATGGGACTTGG + Intronic
1171309391 20:24134444-24134466 CAAGGGGTGCAGATGGAGCTTGG + Intergenic
1173074869 20:39808076-39808098 CAAGGGGGGCAGAAGGCCCTAGG + Intergenic
1175418042 20:58814682-58814704 CAAGGGTCACAGCTGGGACATGG - Intergenic
1176522348 21:7833893-7833915 GAAGGAGGACAGAAGAGACTGGG - Intergenic
1176878813 21:14166965-14166987 AAAGGGTGACAGATGGCACCTGG + Intronic
1178656368 21:34463905-34463927 GAAGGAGGACAGAAGAGACTGGG - Intergenic
1179040257 21:37796451-37796473 GAAGGGTGGCAGATGGGACCAGG + Intronic
1179504315 21:41830853-41830875 TCAGAGGGACAGATGGCACTGGG - Intronic
1179658189 21:42858605-42858627 CATGAGGGACAGATGGGGCCTGG + Intronic
1179985855 21:44919914-44919936 GAAGGGGGCCAGGTGGGCCTGGG + Intronic
1182149375 22:28017637-28017659 AAAGTGGGCCAGATGGGCCTGGG + Intronic
1182287083 22:29254943-29254965 CAAAGGGGACACCTGGGACCAGG - Intronic
1183023671 22:35047804-35047826 TAAGGGGTATAGAGGGGACTGGG - Intergenic
1183348249 22:37319660-37319682 CAAGTGGGAGAGGTGGGAGTGGG - Intergenic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
1184046674 22:41976605-41976627 CAGCGGGGAGAGACGGGACTGGG + Intronic
1184596331 22:45516296-45516318 GTAGGGGGACAGATGGGAACTGG + Intronic
1184695946 22:46139205-46139227 CAAAGTGGGCAGAAGGGACTGGG + Intergenic
1185001787 22:48250695-48250717 CAAGCGGGAGAGATGTGACCGGG - Intergenic
949822898 3:8135162-8135184 CAAGGGGGTGAGAGGGGGCTGGG + Intergenic
951171088 3:19542785-19542807 CCATTGGGACAGATGGGACTTGG - Intergenic
951283384 3:20779883-20779905 CAAAGAGGAGAGATGGGAATGGG - Intergenic
951574663 3:24101398-24101420 CAAGGGGGACAGCCTGGAGTCGG - Intergenic
953216123 3:40920595-40920617 CAAGGGGCACAGTTTGCACTGGG + Intergenic
954515852 3:51175718-51175740 CCAGGGGTATAGATGGGAGTGGG + Intronic
954881247 3:53837404-53837426 AAAAAGGGGCAGATGGGACTGGG + Intronic
955000469 3:54922825-54922847 CAAGGGGCAAAGAGGGGACTGGG - Intronic
956003913 3:64759059-64759081 CAAGGGATACAGATGTAACTAGG - Intergenic
956701897 3:71966079-71966101 TAAGGGGGACAGATGGGAAGGGG + Intergenic
959642323 3:108655754-108655776 AAAGGGTGACAGATGGCACCTGG + Intronic
959723094 3:109514115-109514137 AAAGGGTGACAGATGGCACCTGG - Intergenic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961771357 3:129252501-129252523 CAAGGGCAACATATGAGACTTGG - Intronic
962374296 3:134847313-134847335 CCAGGAAGACAGCTGGGACTAGG + Intronic
963428944 3:145171702-145171724 CAATGGGGACAAATTGGAGTAGG - Intergenic
964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG + Intronic
967471801 3:189870523-189870545 CATGGGGGCCAGATGGGGGTGGG + Intronic
967950102 3:194834010-194834032 CAAGAGGGGCAGGTGGGAGTGGG + Intergenic
968579122 4:1381552-1381574 CAGGGCGGGCAGATGGGCCTGGG - Intronic
969005822 4:4019438-4019460 AAAGGGTGACAGATGGCACCTGG - Intergenic
969329414 4:6464790-6464812 TAAGGGGGAACGATGGGAGTAGG + Intronic
969636154 4:8370484-8370506 CAGAGGGGACAGAGGGGCCTGGG + Intronic
969950326 4:10829070-10829092 AAAGGGTGACAGATGGCACCTGG - Intergenic
970020899 4:11567570-11567592 AAAGGGAGGCAGATGGAACTGGG + Intergenic
970173159 4:13309053-13309075 CAAAGGGAACAGAGAGGACTGGG - Intergenic
970652379 4:18193104-18193126 TCCGGGGCACAGATGGGACTTGG - Intergenic
971438693 4:26655755-26655777 AAAGGGTGACAGATGGCACCAGG - Intronic
971774921 4:30950806-30950828 TGAGGGAGACAGAGGGGACTAGG + Intronic
973321418 4:48814164-48814186 AAAGAGGGACAGATGGTTCTCGG + Intronic
973656471 4:53053286-53053308 CCAGGGGGACTGATGGGAGGAGG + Intronic
974962436 4:68720735-68720757 AAAGGGTGACAGATGGCACCTGG + Intergenic
975314728 4:72938692-72938714 CTAGAGGGACAGATGGGAAGGGG - Intergenic
975752057 4:77533917-77533939 AAGGGGTGACAGATGGCACTTGG - Intronic
976383966 4:84434025-84434047 CCAGGAGGACACCTGGGACTTGG + Intergenic
976490765 4:85667386-85667408 CAGGGGTGACAGATGGCACCTGG - Intronic
977250239 4:94681301-94681323 AAAGGGCCACATATGGGACTGGG + Intergenic
982025681 4:151252005-151252027 CAATGGGCACAGATGCCACTTGG - Intronic
984521105 4:180801937-180801959 CAAGGGGTACAGATGGAATGGGG - Intergenic
984818500 4:183859473-183859495 CAGGGGTGGCAGAGGGGACTGGG + Intronic
987062697 5:14257572-14257594 GAAGGGGGACAGACGGGGCGTGG + Intronic
988715830 5:33827122-33827144 CAAGGCTGACAGATGGGCTTGGG + Intronic
989135750 5:38152840-38152862 CCAGGATGACAGATAGGACTTGG + Intergenic
989140864 5:38200080-38200102 CAAGTGGTAGATATGGGACTAGG + Intergenic
989953545 5:50330312-50330334 AAAGGGTGACAGATGGCACCTGG + Intergenic
992246165 5:74825527-74825549 CAAGAAGGAAAGATGGGATTAGG - Intronic
992826512 5:80554671-80554693 CAAGGGGGAAAGGTGGGAAAGGG + Intergenic
993687736 5:90960893-90960915 AAAGTGGGGCAGATGGGACTTGG + Intronic
994606615 5:101975448-101975470 GCAGGGGGAAAGATGGGAGTGGG - Intergenic
994780525 5:104083845-104083867 AAAGGGGGACAAAGGGCACTAGG + Intergenic
995676740 5:114671113-114671135 AAAGGGTGACAGATGGCACGTGG + Intergenic
996540308 5:124624666-124624688 CCAGGGTGAAAGAAGGGACTGGG - Intergenic
996773420 5:127108990-127109012 AAAGGGTGACAGATGGCACCTGG - Intergenic
997381794 5:133443758-133443780 CAAGGGGCAGAGATGGGATGGGG - Intronic
997847402 5:137300542-137300564 CAGGGGAGACAGTTTGGACTTGG - Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1001042833 5:168349103-168349125 CACAGGGAACAGAAGGGACTCGG - Intronic
1001427211 5:171630470-171630492 CTTTGGGGACAGACGGGACTGGG + Intergenic
1002885384 6:1289350-1289372 CAAGGGGGACATGGGGGATTGGG + Intergenic
1002942604 6:1731466-1731488 TAGAGGGGACAGACGGGACTGGG + Intronic
1004260104 6:14100622-14100644 CAAGTATGACAGATGGGACAAGG + Intergenic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1007741488 6:44012576-44012598 GTAGGGGGACAGTTGTGACTTGG - Intergenic
1008446175 6:51594832-51594854 CTTGGGGCACTGATGGGACTTGG - Intergenic
1009662354 6:66631071-66631093 AAGGGGTGACAGATGGGACCTGG + Intergenic
1009695281 6:67095656-67095678 CAGGGGTGACAGATGGCACCTGG + Intergenic
1009969809 6:70614628-70614650 CAAGGGGGACACATGTGCATCGG - Intergenic
1010463834 6:76143608-76143630 AAAGGGTGACAGATGGCACCTGG - Intergenic
1011106679 6:83789327-83789349 GAAGGAATACAGATGGGACTAGG + Intergenic
1011296833 6:85835252-85835274 AAAGGGTGACAGATGGCACCTGG - Intergenic
1013141017 6:107334922-107334944 CAAGGTGGTCAGATGAGCCTAGG + Intronic
1013276246 6:108587416-108587438 CTAGGGGGATTGATGGGAATAGG + Intronic
1014724828 6:124962192-124962214 CAGGCGGGACAGAGGGGTCTGGG - Intergenic
1014748804 6:125231667-125231689 CAAGGGGGATAGAAAGGATTTGG + Intronic
1015179495 6:130346329-130346351 AAAGGGTGACAGATGGCACCTGG + Intronic
1016607151 6:145943192-145943214 CACTGGTGACAGATGGAACTTGG + Exonic
1016860724 6:148716295-148716317 CAAGGTGGATAGATGGGGCTGGG - Intergenic
1017963178 6:159239858-159239880 CCAGGGGGACAGGTGGGGATGGG - Exonic
1019223438 6:170492967-170492989 CAAGGGGCCCAGAGGGGACAGGG + Intergenic
1019709891 7:2513426-2513448 CAAGGGGGAAAGATGGCCCATGG + Intronic
1022850189 7:34253441-34253463 GAAGGGGGACAAATGTGACAGGG - Intergenic
1024313587 7:47992279-47992301 CAAGGGGGAAAAGTGGGGCTAGG + Intronic
1026545650 7:71319683-71319705 GAAGGGGGAGAAAAGGGACTTGG - Intronic
1027258251 7:76444988-76445010 AAAGAGTGGCAGATGGGACTAGG - Intergenic
1027280597 7:76607030-76607052 AAAGAGTGGCAGATGGGACTAGG + Intergenic
1027452769 7:78351658-78351680 CTAGGGGTTCAGATGGGAGTTGG - Intronic
1027768705 7:82379093-82379115 CAGGGGTGAGAGAGGGGACTGGG + Intronic
1028065186 7:86375612-86375634 AAAGGGTGACAGATGGCACCTGG + Intergenic
1028690684 7:93645958-93645980 CAAGGGCTACAGATGGGGGTGGG - Intronic
1029161971 7:98559003-98559025 CAGGGGTAACAGCTGGGACTGGG - Intergenic
1029346150 7:99980265-99980287 AAAGAGGGAGAGATGGGAATGGG + Intergenic
1029559031 7:101290253-101290275 AAAGAGGGAGAGATGGGAATGGG - Intergenic
1030785405 7:113654303-113654325 CATGGGGGAGGAATGGGACTGGG + Intergenic
1031133138 7:117856249-117856271 TAAGGGGGAAAGATGGGAAATGG - Intronic
1031435280 7:121725218-121725240 GAAGGGAGACAGATGGCACCTGG - Intergenic
1031513238 7:122673826-122673848 CTAGGGCGGCAGATGGGACCGGG + Intronic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1035241471 7:157533381-157533403 AGAAGGGCACAGATGGGACTAGG - Intergenic
1035601544 8:900070-900092 AAAGGAGGACAGAGGGCACTGGG + Intergenic
1035625390 8:1067208-1067230 ACTGGGGGTCAGATGGGACTTGG - Intergenic
1036613916 8:10373742-10373764 CAAGTGGGACAGGTGAGAATGGG + Intronic
1037342968 8:17866882-17866904 CAAGGGGGAAAGAAAGGAGTAGG + Intronic
1038378158 8:27063729-27063751 AAGGGGTGACAGATGGCACTTGG - Intergenic
1038434971 8:27529079-27529101 GAAGTGGGAGAGATGGGGCTGGG - Intronic
1039236345 8:35506834-35506856 CAAGTGGGACAGACGTGGCTTGG + Intronic
1039630721 8:39108316-39108338 CCTGGGCGACAGAAGGGACTCGG - Intronic
1041945398 8:63434932-63434954 CAAGGGAGGCAGCTGAGACTGGG + Intergenic
1044803090 8:95977098-95977120 CCAGAGGAAAAGATGGGACTTGG + Intergenic
1045919995 8:107518413-107518435 CAAGGGGGATAAATGGGAGCAGG - Intergenic
1047107418 8:121748330-121748352 GAAGGGGAACTGATGGGGCTTGG + Intergenic
1048045081 8:130765424-130765446 CATGGGGGAAAGATGGGATGAGG + Intergenic
1048190314 8:132282411-132282433 CAAGGGGGACAGATGGGACTGGG - Intronic
1049873364 8:144999436-144999458 AGAGGGGGACAGGTGGTACTGGG - Intergenic
1050115379 9:2258077-2258099 AAAATGGGACAGATTGGACTAGG + Intergenic
1051987216 9:23105342-23105364 AAGGGGGGACAGATGGCACATGG + Intergenic
1053142192 9:35689269-35689291 CAGCTGGGACAGAGGGGACTTGG + Exonic
1053372606 9:37575757-37575779 CAAGGGGCAAATATGGGGCTGGG - Intronic
1053487637 9:38471772-38471794 CAAGGGGGACAGGTAGGTGTGGG + Intergenic
1054740307 9:68799871-68799893 AAAAGTGGACAGATAGGACTAGG + Intronic
1055548527 9:77408549-77408571 AAAGGGTGACAGATGGCACCTGG + Intronic
1056621442 9:88217956-88217978 CAAGGCGGACAGATGGAGCCTGG + Intergenic
1057324739 9:94051096-94051118 AAAGGGGTACAGACGGCACTTGG - Intronic
1057682737 9:97205393-97205415 AAAGGGTGACAGATGGCACCTGG + Intergenic
1060051997 9:120384307-120384329 CAATGGGAAAAGAGGGGACTTGG + Intergenic
1060523299 9:124306615-124306637 CAAGGGGCAGAGTTGGGATTGGG + Intronic
1060660488 9:125402467-125402489 CAAGGGGATCAGAAAGGACTTGG - Intergenic
1062612075 9:137379899-137379921 CAAGGGGCACAGCTGCCACTGGG - Intronic
1203399488 Un_KI270519v1:72976-72998 AAGGGGCGACAGATGGCACTTGG + Intergenic
1188266981 X:28088885-28088907 CAAGTGCCACAGATGGGACAGGG - Intergenic
1190257335 X:48773447-48773469 CAAGGGGGACAGAATGGAGGAGG - Exonic
1191048281 X:56162652-56162674 CAGGGGTGACAGATGGCACCTGG - Intergenic
1191070412 X:56394629-56394651 AAGGGGTGACAGATGGCACTTGG - Intergenic
1191114899 X:56842057-56842079 AAAGGGTGACAGATGGCACCTGG - Intergenic
1193696078 X:84708720-84708742 AAAGGGGGACCTAAGGGACTGGG - Intergenic
1195261013 X:103131639-103131661 AAGGGGTGACAGATGGCACTTGG + Intergenic
1197567086 X:128101157-128101179 CAATGGGGATACATGGGATTGGG + Intergenic
1200070263 X:153525754-153525776 CAGGAGGGAGAGATGAGACTAGG - Intronic
1201308229 Y:12569815-12569837 AAGGGGTGACAGATGGCACTTGG + Intergenic
1202085343 Y:21130818-21130840 CAAGGGTGACAGTTGGGGCCAGG + Intergenic