ID: 1048194533

View in Genome Browser
Species Human (GRCh38)
Location 8:132321506-132321528
Sequence GAGAGCAAACAGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1319
Summary {0: 1, 1: 2, 2: 35, 3: 199, 4: 1082}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048194533_1048194538 0 Left 1048194533 8:132321506-132321528 CCCTCCTGCTTCTGTTTGCTCTC 0: 1
1: 2
2: 35
3: 199
4: 1082
Right 1048194538 8:132321529-132321551 CCTTCCCACACAGACACACAAGG No data
1048194533_1048194541 30 Left 1048194533 8:132321506-132321528 CCCTCCTGCTTCTGTTTGCTCTC 0: 1
1: 2
2: 35
3: 199
4: 1082
Right 1048194541 8:132321559-132321581 TCAGAAGTAGCCAAGCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048194533 Original CRISPR GAGAGCAAACAGAAGCAGGA GGG (reversed) Intronic
900503516 1:3017989-3018011 CAGAGCCAGAAGAAGCAGGAAGG - Intergenic
900661566 1:3787048-3787070 GAGAGGAAGCAGAGGCGGGAAGG - Exonic
900909570 1:5585477-5585499 GAGGGCAAACAGTGGCAAGACGG - Intergenic
901460396 1:9387706-9387728 GAGCTAAAACAGAAGCAGAAGGG + Intergenic
901470962 1:9456188-9456210 GAGAGCAACCCAAAGCTGGAAGG + Intergenic
901608730 1:10479674-10479696 GAGAGGCTACAGAAGCAGGCAGG + Intronic
901625700 1:10623774-10623796 AGGAGCAAACGGCAGCAGGATGG - Intronic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
902096827 1:13952604-13952626 GAGAACAAACAGCAGCAAGCTGG + Intergenic
902123102 1:14184509-14184531 GAGCGGAAGCAGCAGCAGGAGGG + Intergenic
902398273 1:16144072-16144094 GAAAGCAAACAGAAGATGAAAGG - Intronic
902404775 1:16176612-16176634 TAGAGAAAACAGACACAGGAAGG - Intergenic
902411917 1:16216770-16216792 GCGAAGAAACAGAAGCAGAAAGG + Intergenic
903315324 1:22499283-22499305 GAGAGAAAACACAGGCAAGATGG + Intronic
903473629 1:23604796-23604818 GAGGTCATACTGAAGCAGGATGG + Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903737770 1:25541245-25541267 GAGAGCATTCTGAAGCAGGGAGG - Intergenic
903982215 1:27197368-27197390 GAGAGGAAACGGCAGGAGGAAGG - Intergenic
904423096 1:30406552-30406574 GGGAGCAAACACAAGAGGGATGG + Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
905768967 1:40625217-40625239 GAAAGCAAGCAGAGGCAGGTGGG + Exonic
905843394 1:41205214-41205236 GAGGGCAAGCCGAAGCATGACGG + Intronic
906243091 1:44254346-44254368 GAAAGCAAACAAAAGCTAGAAGG - Intronic
906586667 1:46984553-46984575 GAAGGCAAGCTGAAGCAGGATGG + Intergenic
906740033 1:48173516-48173538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907455203 1:54571261-54571283 GAGAGAAGAAAGAAACAGGAAGG - Intronic
907870506 1:58438571-58438593 AGCAGCAAACATAAGCAGGAGGG - Intronic
908598361 1:65711825-65711847 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
908601477 1:65744520-65744542 GAGGGCAAGCAGAAGCCGGGTGG - Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
908911028 1:69072345-69072367 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
909221668 1:72970793-72970815 GAGAGGAAAAAAAAGCATGAGGG - Intergenic
909342251 1:74545238-74545260 TAGAGCAAAAAGGTGCAGGAAGG + Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909502339 1:76349043-76349065 GGGAGAAAACAGAAGCAGCATGG - Intronic
909557398 1:76969190-76969212 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909920492 1:81375395-81375417 GATAGCAAACAGCAGCAAGATGG + Intronic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910281696 1:85508491-85508513 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910635784 1:89405728-89405750 GAGAGCGAGCAGAAGCAGGGTGG - Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911566620 1:99469933-99469955 GAAAACAACCAGGAGCAGGAAGG - Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
911700826 1:100949985-100950007 GAGAGCGAGCTGAAGCAGGGTGG - Intronic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912510073 1:110183640-110183662 GAGAGGAGAAATAAGCAGGAGGG + Intronic
912659695 1:111516467-111516489 GAGAGGAAACAGATGCTGGCTGG - Intronic
912675714 1:111679235-111679257 GAGGGCTAGCAGAAGCAGGGTGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913513758 1:119585354-119585376 GAAAGAAAACAGACCCAGGAAGG - Intergenic
913517419 1:119616328-119616350 GAAAGGAAACAGACGCAAGAAGG - Intergenic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914400271 1:147313031-147313053 GAGAGCAAAAAGGAGCAGAAAGG + Intergenic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
915046045 1:153018114-153018136 GAGAGCAAGGAAAAGCAGGCTGG + Intergenic
915054170 1:153110537-153110559 GAGAGCACATAGACACAGGAAGG + Intergenic
915166847 1:153952690-153952712 GACAGGAAGCAGAAGCAGGTGGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915580166 1:156808701-156808723 GGGAGTACACAGAAGCAGGCTGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
916084966 1:161261853-161261875 GAGAGCAAACAGGATAATGAAGG - Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916140462 1:161693008-161693030 GAGAGCGAGCAGAAGCAAGATGG + Intergenic
916183292 1:162106269-162106291 GACAGCAAAGAGAAGCAGGATGG - Intronic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
916271137 1:162942889-162942911 GAGAGCAGTGAGAAGCAGCATGG - Intergenic
916362788 1:163990127-163990149 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
916973368 1:170048683-170048705 GAGAGCAAGCAGAAGCGGGGTGG + Intronic
916986099 1:170192413-170192435 GAGAACAAAGAAAAGCAGGGTGG - Intergenic
917019293 1:170569019-170569041 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917068791 1:171126587-171126609 AAGAGAAAACAGAAACAGGTTGG + Intergenic
917157864 1:172024647-172024669 GAGGGCAAGCCAAAGCAGGATGG + Intronic
917257584 1:173132216-173132238 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
917357680 1:174143717-174143739 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
917573717 1:176297065-176297087 GAGGGCAAGCCGAAGCAGGGAGG - Intergenic
917682838 1:177385094-177385116 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
917716479 1:177743161-177743183 GTGAGGAAACTGAAGCAGAAAGG - Intergenic
918007334 1:180554243-180554265 AGGAGCCAACAGAAGCTGGAAGG + Intergenic
918360474 1:183751845-183751867 GAGAGCAAGCATAAGCAGGGTGG - Intronic
918515571 1:185359067-185359089 GGGAGTAAGCAGCAGCAGGATGG - Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918786212 1:188768332-188768354 GAGAGCAAGGCAAAGCAGGATGG + Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919598910 1:199599278-199599300 GAGAGCGAGCTGAAGCAGGGTGG + Intergenic
920067367 1:203278417-203278439 GTGTCCAAACAGCAGCAGGAAGG - Intergenic
920197982 1:204242178-204242200 ATGAGCAAACAGAACCAGGCGGG + Intronic
920206959 1:204299246-204299268 GAAAGCAAACAGGAGGAAGAAGG + Intronic
920278607 1:204826998-204827020 GGGAAGAAAAAGAAGCAGGAAGG + Intergenic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920844970 1:209585968-209585990 GAAAGCAAACTGAAGCAGGCAGG + Intronic
920948946 1:210554913-210554935 AAGAGAAAACACCAGCAGGATGG - Intronic
921004088 1:211075752-211075774 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
921209388 1:212879911-212879933 GAGAGCAAACAGCAACAGTTGGG - Intronic
921344837 1:214172461-214172483 GAAAGCAAACATTTGCAGGATGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921811381 1:219518271-219518293 GAGATCCAACAGCAGAAGGAAGG + Intergenic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922562313 1:226578149-226578171 GAAAGCACACAGAAGCAAGATGG - Intronic
922789479 1:228303278-228303300 GGAAGAAAACAGAAGCAGGAAGG - Intronic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923666753 1:236004871-236004893 GGGATCAAACTTAAGCAGGATGG + Intronic
924247250 1:242096939-242096961 GAGAACACACAGACACAGGAAGG - Intronic
924295930 1:242586785-242586807 GAGGGCAAGCCGAAGCAGGGAGG + Intergenic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1063312488 10:4967500-4967522 GAGAGGAAGCAGAAGCAACAAGG - Intronic
1063315444 10:5000065-5000087 GAGAGGAAGCAGAAGCAACAAGG + Intronic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063879747 10:10518944-10518966 CAGACCAAAAAGAATCAGGAAGG + Intergenic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065651656 10:27899155-27899177 GAGGGCAAGCAGAAGCAGACTGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1066127295 10:32354188-32354210 CTTAGCAAACAGTAGCAGGATGG + Intronic
1066159578 10:32714246-32714268 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1066686840 10:37989697-37989719 GAAAGCAAAGAGAAGCATGATGG + Intergenic
1067004082 10:42644829-42644851 GAGAGCTAAAAGAAGCTGGAGGG + Intergenic
1067162251 10:43836844-43836866 GAGAGCAAGCCAAAGCAGGGTGG - Intergenic
1067209776 10:44250199-44250221 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067373431 10:45705717-45705739 TTGAGAAAACAGAAGCAGAAAGG + Intergenic
1067380262 10:45766497-45766519 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067887963 10:50107151-50107173 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067967723 10:50932344-50932366 GATAGCAAACACCAGCAGGCTGG - Intergenic
1068086175 10:52375521-52375543 GAAGGCAAGCAGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068728331 10:60327672-60327694 GATATCAAACAGAAGAAAGAAGG - Intronic
1068966233 10:62914743-62914765 GAGAGCAAAGAGTATCAGAATGG - Intronic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1069245719 10:66202759-66202781 GAGAGGAAAGAGAAGTAGTATGG - Intronic
1069370850 10:67746542-67746564 GAGAGCAAAGAAAAGCAGAGTGG + Intergenic
1069772022 10:70906165-70906187 GAGAGTAAGAAGAAACAGGATGG - Intergenic
1070109457 10:73469655-73469677 GAGACCAAACAGTAGCATGCTGG - Intronic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070472390 10:76795731-76795753 GAGGACAAAGAGATGCAGGAGGG + Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070999653 10:80817722-80817744 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1071727537 10:88214977-88214999 GATAGCAAAGAGAAGAAAGAAGG - Intergenic
1071917450 10:90310650-90310672 GAGAGCACATGGAGGCAGGATGG + Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073200683 10:101732726-101732748 GAGCCCAAGCAGAAGCAGCACGG - Intergenic
1073440389 10:103549225-103549247 CTGAGCAAACAGAACCTGGATGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073559026 10:104481395-104481417 CAGAGCAAACAGAAACTGGGAGG - Intergenic
1073574142 10:104607709-104607731 GACAACAAACAGGAGCTGGATGG + Intergenic
1074016848 10:109542869-109542891 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1074430040 10:113386689-113386711 GAGAGATCAAAGAAGCAGGAAGG - Intergenic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074536893 10:114334543-114334565 GAGAGCCAAGAGGAACAGGAGGG + Intronic
1074930469 10:118120228-118120250 GATAGCAACCAGAAGAAGCAAGG - Intergenic
1075129225 10:119724752-119724774 GAGAGGGTACAAAAGCAGGAAGG - Intergenic
1075984003 10:126767338-126767360 GAGGGCAAGCAGAACCAGGGTGG - Intergenic
1076065522 10:127444853-127444875 GGGAGCCACCAGAAGCTGGAGGG - Intronic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1076947282 10:133659923-133659945 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077737822 11:4809821-4809843 TAGAGCTCCCAGAAGCAGGAAGG - Intronic
1077803784 11:5569427-5569449 GAGGGCAAACCAAAGCAGGGTGG + Intronic
1077893884 11:6439633-6439655 GAGAGAGAAAAGAGGCAGGAGGG + Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1078398995 11:11007725-11007747 GAGAACAAGAGGAAGCAGGAGGG - Intergenic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078691139 11:13582125-13582147 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1078732990 11:13992849-13992871 GAGAGCAAGCCAAAGCAGGATGG - Intronic
1078941419 11:16010602-16010624 AAGAGAAAAAAGAAACAGGATGG + Intronic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079541626 11:21582971-21582993 GTGAGAAAGCAGTAGCAGGATGG - Intergenic
1079588134 11:22150493-22150515 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1080085721 11:28279430-28279452 GAGAACAAACAGAAACATGGTGG - Intronic
1080235886 11:30067595-30067617 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1080871282 11:36239384-36239406 AACAGCAAACAGAAAAAGGAGGG - Intergenic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080965703 11:37211410-37211432 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081095042 11:38921610-38921632 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081365928 11:42235018-42235040 GAGAGCCAAGAGTAGCAGCATGG + Intergenic
1081682456 11:45017783-45017805 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1081765898 11:45610007-45610029 GTGAGCAGTCAGAAGCAGCATGG + Intergenic
1082593427 11:55043922-55043944 GAGAACACATAGAAACAGGAAGG - Intergenic
1082628372 11:55511826-55511848 GAGAGAAGAAAGAAGCAGGAAGG - Intergenic
1082720618 11:56670839-56670861 GAGAGCAAATAGATGCAGTAGGG - Intergenic
1082993842 11:59233398-59233420 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083764386 11:64835104-64835126 GAGAGCAAGCAGCGGCTGGAGGG - Exonic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084957411 11:72698652-72698674 GCGAGCAAGCAGAGGCTGGAGGG - Intronic
1085783189 11:79428034-79428056 GGGAGAAAGCAGAAGCAGGAAGG + Intronic
1085791559 11:79501396-79501418 ATAAGCAAACAGAAGCAGGGCGG - Intergenic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086410633 11:86540984-86541006 GAGAGCAAGGTGAAGCAGGGTGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086532445 11:87801482-87801504 GAAAGGAAACTGAAGCAGGGTGG - Intergenic
1086732980 11:90271526-90271548 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1087003503 11:93445058-93445080 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1087596046 11:100256646-100256668 GAGGGCAAGCTGAAGCAGCATGG + Intronic
1087616757 11:100494619-100494641 GAGAACACACAGACACAGGAAGG + Intergenic
1087667705 11:101070169-101070191 GAGAGCGAGCTGAAGCAGGGTGG + Intronic
1088075597 11:105844891-105844913 GACAGTAAACAGGAGCAGTATGG + Intronic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088973860 11:114797374-114797396 GAGAGAAAATAGAAGAAGGTGGG - Intergenic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1089879888 11:121763231-121763253 GAGAGCACACAGCATCAGCATGG + Intergenic
1090307407 11:125703289-125703311 GAGCGCAAGCAGAAGCAGGGTGG + Intergenic
1090312614 11:125755768-125755790 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1090348150 11:126087575-126087597 GAAAGCAAAAAGAAGTTGGAGGG + Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090722943 11:129493625-129493647 GAGGGCAAGCTGAAGCAGGGAGG + Intergenic
1090725172 11:129518394-129518416 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090858065 11:130628740-130628762 AAGAGCAAAGAGAAGCTTGAGGG + Intergenic
1091109488 11:132952561-132952583 GATAGAAAAGAGAAGCAGGTTGG - Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091757993 12:3067886-3067908 GAGAGTAAACCCAAGCAGGTAGG - Intergenic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092806445 12:12227939-12227961 AACAGCAAACTGAAGCAGAAAGG - Intronic
1092831315 12:12447255-12447277 GGGAGCAGACACCAGCAGGAGGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093658225 12:21722327-21722349 GAGAGGAAGGAGAAGCACGATGG - Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094147127 12:27242477-27242499 GAGAGCAAGGACAAGCAAGATGG + Intergenic
1094527871 12:31244653-31244675 TACAGCAAACTGAAGCAAGAAGG + Intergenic
1094861318 12:34469645-34469667 TGGAGCCTACAGAAGCAGGAAGG + Intergenic
1095230579 12:39734203-39734225 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1095356334 12:41280059-41280081 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095831545 12:46591964-46591986 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
1095930852 12:47624000-47624022 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1096524151 12:52200707-52200729 GAGGGCAAACAGTGCCAGGAGGG + Intergenic
1096599047 12:52716460-52716482 GAGAGCATCAAGAAGCAGGTGGG - Intergenic
1096715189 12:53486946-53486968 GAGCACAAGCAGCAGCAGGAAGG - Exonic
1096953807 12:55504885-55504907 GAGAACACATGGAAGCAGGAAGG - Intergenic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097498356 12:60372840-60372862 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098460770 12:70730846-70730868 GAGAGCAGAAGGAAGGAGGAAGG + Intronic
1098780078 12:74676229-74676251 GAGGGCAAGCAGAAACAGGGTGG + Intergenic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1098993935 12:77096428-77096450 GAGGGCAAGCGGAAGCAGGGAGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099522432 12:83681382-83681404 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1099699036 12:86061204-86061226 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099897473 12:88667300-88667322 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1100698263 12:97119025-97119047 GAGATGAAACAGCAGCTGGAAGG - Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100780690 12:98023032-98023054 AAGAGCAAACAGAAGAGGCAAGG - Intergenic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101187308 12:102292545-102292567 GAGAGCAAGAAAAAGCAGGGTGG - Intergenic
1101218375 12:102608852-102608874 GTCAGCAAACAGATGCTGGAGGG + Intergenic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102003824 12:109575903-109575925 GAGAGCAAACATAAGCACAGAGG - Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103255736 12:119539978-119540000 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1103777822 12:123379596-123379618 GAGAGCAGATAGAAGCAGTCTGG - Intergenic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1105403183 13:20113318-20113340 GAGAGGACACAGGAGCAGCAAGG + Intergenic
1105579165 13:21677319-21677341 AAGAGCAAAGAAAAGAAGGAAGG - Intronic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106025724 13:25953698-25953720 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106198553 13:27515685-27515707 GAGAGCAAACAACAGTGGGAAGG + Intergenic
1106317216 13:28605200-28605222 GAGAACACACAGACACAGGAAGG - Intergenic
1106336112 13:28784476-28784498 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107271032 13:38616190-38616212 GAGAGCACACAGTCACAGGACGG + Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107551563 13:41480577-41480599 GAGAGCGAGCTGAAGCAGGGTGG - Intergenic
1107671023 13:42746362-42746384 GATTTCAAACAGCAGCAGGATGG - Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108251413 13:48571571-48571593 GACAGCAAACAGCCCCAGGAGGG + Intergenic
1108479658 13:50856009-50856031 GAGAACAAAGAAAAGCAGGGTGG + Intergenic
1109195846 13:59376967-59376989 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1109366523 13:61364060-61364082 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1109669383 13:65585316-65585338 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109731468 13:66419500-66419522 GAGGGCAAGCAGAAGCAGAGTGG + Intronic
1110389631 13:74959287-74959309 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1110785834 13:79524587-79524609 CATAGCAAACAGATTCAGGATGG + Intronic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111522983 13:89428735-89428757 GAGAACAACAAAAAGCAGGATGG - Intergenic
1112434842 13:99384527-99384549 GAAAGCCACCAGAAGCAGGGAGG - Intronic
1112445872 13:99463571-99463593 GTGAGCACACAGCAGCAGGAAGG + Intergenic
1112552754 13:100436930-100436952 GAGAGCAAAAAGAAACAAGAGGG + Intronic
1112584507 13:100706288-100706310 GAGAGGAAAGAAAAGAAGGAAGG - Intergenic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1113243110 13:108362028-108362050 GAGAGGAAACAGGTGCAGGATGG + Intergenic
1113340549 13:109420142-109420164 GAGAGCAATCAGCAGCATGATGG - Intergenic
1113378831 13:109785653-109785675 GAGAACGAGCAGGAGCAGGAGGG - Exonic
1114335943 14:21690109-21690131 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114433705 14:22685868-22685890 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1114817578 14:25978996-25979018 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114958116 14:27848940-27848962 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1115026380 14:28751665-28751687 GAGAGAAAATAGATCCAGGAAGG + Intergenic
1115124106 14:29972178-29972200 GAGGGCAAACAGAAGCAAAGTGG + Intronic
1115305105 14:31925495-31925517 GAAAGCAAACAGAAAAAGGCAGG + Intergenic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115579163 14:34741316-34741338 GACAGCAAGCCGAAGCAGGGTGG + Intergenic
1115867315 14:37761293-37761315 GAAGGCAAGCAGAAGCAGGGTGG - Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1116009346 14:39332715-39332737 GACTGCAAGCAGAAGCAGGGTGG - Intronic
1116091256 14:40309630-40309652 GAGACCAAAAAGAAGCCAGAAGG + Intergenic
1116243873 14:42383016-42383038 GAGAGGAATGAGAAGCAGGCTGG - Intergenic
1116315157 14:43376948-43376970 GAAAGAAAAGAGAGGCAGGAAGG - Intergenic
1116428572 14:44820165-44820187 GAGAGCAAAGAAAAGTAGGCTGG + Intergenic
1116620311 14:47193512-47193534 GAGATCAAAGATAAACAGGATGG - Intronic
1116677162 14:47920365-47920387 GACAGCAAAGAAAAGCAGGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117169996 14:53084796-53084818 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1117185015 14:53231391-53231413 GAGGGCAAGTAGAAGCAGGGAGG + Intergenic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1117859288 14:60073331-60073353 GAAGGCAAGCAGAAGCAGGTGGG + Intergenic
1118516178 14:66530754-66530776 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1118517937 14:66547088-66547110 GAAGGCAAAAAGAAGCATGAGGG - Intronic
1119018564 14:71085138-71085160 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119948578 14:78720623-78720645 GAGAGTGGACAGATGCAGGATGG - Intronic
1120044564 14:79791259-79791281 GAGAGCAACCACAAGCAGAGAGG - Intronic
1120065720 14:80038947-80038969 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1120271863 14:82322389-82322411 GTGGGCAAGCAGAAGCAGGGTGG - Intergenic
1120338651 14:83190581-83190603 GTGAGCTAGCAGAAGCAGGGTGG - Intergenic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1120670264 14:87354930-87354952 GAGAACACACGGAAACAGGAAGG - Intergenic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120747626 14:88166366-88166388 GAAAGCAAAGAGAAACAGAAAGG + Intergenic
1120770038 14:88369693-88369715 GAGAGCAAGCAGAAGAAAGATGG + Intergenic
1120843677 14:89108238-89108260 AAGAGGATAGAGAAGCAGGAAGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121786596 14:96666180-96666202 GAGAGCAAAGGGAAGACGGAGGG - Intergenic
1121787927 14:96676660-96676682 GAGAGCAAGCAGTAGCATGCAGG - Intergenic
1121828630 14:97031027-97031049 GAGAGAGAACAGAAGCACAAGGG + Intergenic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1122501352 14:102202150-102202172 GAGAGCACAGGGAAGCAGGGTGG - Intronic
1122625881 14:103085175-103085197 GAGAGCAGAGACCAGCAGGATGG - Intergenic
1202921338 14_KI270723v1_random:32476-32498 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1202923572 14_KI270724v1_random:5104-5126 GAAGTCAAACAGAAGCAGGTGGG - Intergenic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1124208663 15:27744306-27744328 TAAAGCAAGCAAAAGCAGGATGG + Intergenic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1126277946 15:46906708-46906730 GAGAACACACAGACACAGGAAGG - Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126582589 15:50254966-50254988 GGGAGCAAACACATCCAGGAGGG - Intronic
1126867409 15:52951343-52951365 GAGTGGAAACAAAAGCTGGATGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127029938 15:54850878-54850900 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1127137968 15:55944158-55944180 GAGGGCAAGCCGAAGCAGGATGG + Intronic
1127965619 15:63920774-63920796 GAGAACAAGCAGGAGCAGCAGGG - Intronic
1128339884 15:66813971-66813993 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1128882388 15:71255741-71255763 GAGAGCAAACTGAGGCATGGAGG - Intronic
1129166415 15:73780738-73780760 GAGAGCCAGCAGAGGCAGGGGGG + Intergenic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1129853007 15:78805552-78805574 GAAAGGAAACACAAGCATGATGG - Intronic
1130249955 15:82293495-82293517 GAAAGGAAACACAAGCATGATGG + Intergenic
1130288306 15:82573403-82573425 GTGAACATAGAGAAGCAGGAGGG - Intronic
1130936308 15:88473757-88473779 GAGAGCTCACAGAAGGAGGCAGG - Intronic
1131457425 15:92593404-92593426 GAAAGCACACAGAAGCAGCCAGG - Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1132024469 15:98393047-98393069 GAGAGGGAACAGGAGCAGGAAGG + Intergenic
1132038217 15:98503852-98503874 GGGAGCAAAAAGGGGCAGGAAGG - Intronic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133502609 16:6379975-6379997 GAGAGAGAGCAGATGCAGGAAGG + Intronic
1133691024 16:8215309-8215331 GAGACCAAACAGAGGAAGAAGGG + Intergenic
1133795148 16:9040256-9040278 GAGAGCAAGATGAAGCTGGAAGG + Intergenic
1133905833 16:10021566-10021588 GACAGCAAAGATAGGCAGGAGGG + Intronic
1134312942 16:13092793-13092815 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1134403129 16:13930230-13930252 GAGGGCATACACAAGCACGATGG - Intronic
1134864221 16:17590465-17590487 GAGAGAAAACAGAAGCACCAAGG + Intergenic
1135037848 16:19093147-19093169 GAGAAGAAATAAAAGCAGGAAGG - Intergenic
1135897295 16:26419385-26419407 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1137325020 16:47425417-47425439 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1137336560 16:47554812-47554834 GAGAGCGAGCTGAAGCAGGGTGG - Intronic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1137571405 16:49568595-49568617 GAGAGCAGGCGGAGGCAGGAAGG - Intronic
1137696403 16:50464935-50464957 GACAGCACACAGAAGCGGGGTGG - Intergenic
1137772625 16:51029055-51029077 GAGAACAAACGGACACAGGAAGG - Intergenic
1137889659 16:52145790-52145812 CAAAGCAAACTGAAGCAAGAAGG + Intergenic
1138643988 16:58409433-58409455 GAGCTCAAACAAAAGCAGGCTGG - Intergenic
1138680636 16:58681387-58681409 GAGAGCAAAGAGAATCAGTCAGG - Intronic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1139481927 16:67235626-67235648 GAGAGCTGACAGAGGCTGGAGGG - Intronic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140265384 16:73416170-73416192 GAGAGAAAACAGAAGCTCAAAGG + Intergenic
1140863270 16:79037838-79037860 GAGAGCAGGCAGGAGCTGGATGG - Intronic
1141636610 16:85317330-85317352 GAGAGCCAAGAGGAGAAGGAGGG - Intergenic
1143916940 17:10301282-10301304 GTGTGCAACCAGCAGCAGGAAGG + Intronic
1144175917 17:12707407-12707429 AAAAGCACACAGAAGCAGGCTGG + Intronic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1144482349 17:15638571-15638593 GAGAGAAAACAGCACCTGGAGGG - Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1146535984 17:33652617-33652639 GAAAGCAAATAGCAGAAGGAGGG - Intronic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147644984 17:42028045-42028067 GAGACCCAACTGAAGCAGGTGGG - Exonic
1147957991 17:44148224-44148246 GAGAGCCAACAGCAGCAAGTTGG + Exonic
1148000201 17:44383400-44383422 GAGGGCAGCCAGAACCAGGATGG - Intronic
1148068139 17:44888679-44888701 GAGAAAAAAGAGAAGCAGTAAGG + Intronic
1148548189 17:48532574-48532596 GAGAGGAAAGGGAAGCAGGTGGG + Intergenic
1148897797 17:50850084-50850106 GAGAGGAAAAAGAAGAGGGATGG + Intergenic
1149168238 17:53779838-53779860 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150506647 17:65705568-65705590 GAGAACAAAAAGAAAAAGGAAGG + Intronic
1151463263 17:74268426-74268448 GAAAGAATAAAGAAGCAGGAAGG + Intergenic
1151559318 17:74862088-74862110 GACTGGAAACGGAAGCAGGAAGG + Intergenic
1152231196 17:79114891-79114913 GAGAGCAAAGAGAGCCAGCAGGG - Intronic
1152484162 17:80578848-80578870 GGGAGCAGAAGGAAGCAGGAGGG + Intronic
1152753418 17:82077124-82077146 GAGAGCCGGGAGAAGCAGGAGGG + Intergenic
1203171185 17_GL000205v2_random:148923-148945 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1153059459 18:980389-980411 GAGGGCAAGCCGAAGCAGGTTGG - Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153702527 18:7711177-7711199 GAGGGCAAGCAGAAACAGGGTGG + Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1154490102 18:14915200-14915222 GAGAGCAAACAGCAGCAGACAGG + Intergenic
1155077993 18:22379618-22379640 GACAGCCACCAGAAGCTGGAAGG + Intergenic
1155114141 18:22748455-22748477 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1155373703 18:25133287-25133309 GGGAGCAAACAGAAGTAGTGAGG - Intronic
1155554343 18:27001641-27001663 CCCAGCAAACAGAATCAGGAGGG - Intronic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156294570 18:35777677-35777699 GTCAGGAAAAAGAAGCAGGAAGG + Intergenic
1156332214 18:36132957-36132979 GAGAGTGAGCAGAAGCAGGTGGG + Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1156739688 18:40309326-40309348 GAGAGAATACAGCCGCAGGAAGG - Intergenic
1157103493 18:44751175-44751197 GGGAGGAGAAAGAAGCAGGAAGG + Intronic
1157144510 18:45148044-45148066 GAGAGTAAACGGGAGCAGAAGGG - Intergenic
1157424784 18:47575720-47575742 GAGAGAGAACATAAGCACGAGGG - Intergenic
1157690481 18:49677962-49677984 GAATGAAAACAGAAGCAGGAAGG - Intergenic
1157790233 18:50524775-50524797 GACACCATACAGAAGCAGTAGGG - Intergenic
1157883310 18:51342378-51342400 GAGAGGTAACAGCAGCAGGAAGG + Intergenic
1158399116 18:57104800-57104822 GAGGGCAAGCAAAAGCAGGGTGG - Intergenic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1158853288 18:61517432-61517454 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159076550 18:63687884-63687906 GAGAGCAAGCCCAAGCAGGTTGG + Intronic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159438491 18:68447796-68447818 AAGAGCTATCAGAATCAGGAAGG - Intergenic
1159546505 18:69845573-69845595 GAGAGAATAGAGAGGCAGGATGG + Exonic
1159570830 18:70110409-70110431 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159723014 18:71916911-71916933 GAAACCAAACTGAAACAGGAAGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160296213 18:77639418-77639440 GAAAGCAAAAAAAAGCAGGGTGG + Intergenic
1160667711 19:340852-340874 GAGGGCAAACAGAAGACAGAGGG + Intronic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1162082290 19:8225372-8225394 GACAGTGAATAGAAGCAGGAAGG + Intronic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164047622 19:21555931-21555953 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1164074319 19:21800258-21800280 GAGAAAAAAAAGTAGCAGGAGGG + Intergenic
1164599661 19:29552419-29552441 GAGAGCAAGGAAAAGCAGGGTGG + Intronic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165470855 19:36003681-36003703 GAGAGCAGCCAGCAGCAGAATGG + Intronic
1166521158 19:43481183-43481205 GTTAGAAAACTGAAGCAGGATGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167674527 19:50876114-50876136 GAGAAAGAACAGAACCAGGAAGG - Intronic
1168530937 19:57128061-57128083 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
925415220 2:3665503-3665525 GAGAACACACGGACGCAGGAAGG - Intronic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
925663045 2:6223011-6223033 GATAGCAGGCAGCAGCAGGAAGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926475443 2:13315324-13315346 GAGAGCAAGGAAAAGCAGGTTGG - Intergenic
926566147 2:14476615-14476637 GAGAGCAGACAGAGGAAGAAAGG - Intergenic
926944062 2:18168501-18168523 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927585879 2:24304752-24304774 TAGAGCAAACAGAAGAGAGAAGG + Intronic
928070931 2:28215760-28215782 GAGAGCAGAAAGAAGCAGAGGGG - Intronic
928252891 2:29697344-29697366 GAGAGAAAAGAGAGGCAGGAAGG + Intronic
928462609 2:31489234-31489256 GAGGGCAAGCTGAAGCAGGGGGG + Intergenic
928750564 2:34466362-34466384 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929589327 2:43134760-43134782 GAGAGCAGAGAGAAGCTTGAGGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930274778 2:49298614-49298636 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
932903154 2:75723363-75723385 GAGAGCAAGCAAAAACAGGGTGG - Intergenic
932929090 2:76012477-76012499 GAGAACACACAGACACAGGAAGG - Intergenic
933329825 2:80879722-80879744 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
934524435 2:95042899-95042921 GAGAGCAAACAGAGTAAGAAGGG - Intronic
935205043 2:100890078-100890100 GTATGCACACAGAAGCAGGAGGG - Intronic
935273976 2:101460215-101460237 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
935496250 2:103785040-103785062 GAAAGCAAACAGCAAAAGGATGG + Intergenic
935872208 2:107463425-107463447 GTAAGAAAACAGAAGCAGGCCGG + Intergenic
935883748 2:107593204-107593226 GAGAACACACAGACACAGGAAGG - Intergenic
936076746 2:109406092-109406114 GGGTGCAAACATGAGCAGGACGG - Intronic
936909842 2:117579381-117579403 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
937000054 2:118457577-118457599 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937526055 2:122771923-122771945 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937606225 2:123804544-123804566 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940057250 2:149525981-149526003 GAGAACAAAGAAAAGCAGGGTGG - Intergenic
940066288 2:149633588-149633610 GAAAGAATACAAAAGCAGGAAGG + Intergenic
940124433 2:150309022-150309044 GAGATCAAAGAAAAGCAGGGTGG + Intergenic
940124774 2:150311163-150311185 GAGAACTAGCAGAAGCAGGGTGG + Intergenic
940141018 2:150490506-150490528 GGGAGCAAAAGGAAGCAGGCAGG + Intronic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940378034 2:152979560-152979582 GAGAGACACTAGAAGCAGGAAGG - Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940417899 2:153443343-153443365 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940821321 2:158359527-158359549 GACAGCAAGCCGAAGCAGGGTGG + Intronic
940876765 2:158905705-158905727 GAAGGAAAACAGAAACAGGAAGG + Intergenic
941081630 2:161067962-161067984 GAAAGCAAAGAGAAGCCGGAGGG + Intergenic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941628384 2:167856261-167856283 AAGAGCAAAAAGCAGAAGGAAGG + Intergenic
941777085 2:169405088-169405110 GAGAACACACAGACACAGGAAGG + Intergenic
941812842 2:169771200-169771222 GAAAGGAAACAGAAACGGGAAGG - Intronic
941845208 2:170125746-170125768 GAGAGCGAGCCGAAGCAGGGTGG + Intergenic
942065846 2:172270703-172270725 GAGGGCAAGCAGAAGCAGTGTGG - Intergenic
942199821 2:173559758-173559780 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
942514997 2:176742526-176742548 GAGAGACAGCAGAAGCAGGCTGG + Intergenic
942744071 2:179212168-179212190 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
942812395 2:180014355-180014377 GAGAGCAAAAGAGAGCAGGAGGG - Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943074725 2:183179821-183179843 GAGGGCAAGCAGAAACAGGGTGG - Intergenic
943094803 2:183416464-183416486 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944291952 2:198018077-198018099 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
944374729 2:199028621-199028643 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
944520382 2:200560079-200560101 AACAGACAACAGAAGCAGGAAGG - Intronic
944674303 2:202022346-202022368 GAGAGCACATGGAGGCAGGAAGG + Intergenic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945024414 2:205606398-205606420 GAGAGCAAGGAAAAGCAGGGTGG - Intronic
945116800 2:206416045-206416067 GAGGGCAAGCCGAAGCAGGGCGG - Intergenic
945243475 2:207697713-207697735 GACAGGGAACAGAAGTAGGAAGG + Intergenic
945244933 2:207709571-207709593 GAGAGCAAAGGGAAGCAAGTAGG - Intergenic
945431032 2:209766010-209766032 GAGAACACACGGAAACAGGAAGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945509749 2:210686589-210686611 AAGAGTAAACAAGAGCAGGAGGG + Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
945945125 2:215988240-215988262 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
946236501 2:218327517-218327539 GAGAGCAGAGAGCAGCAGGGAGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946566762 2:220974126-220974148 GAAAGAAAACAAAAGAAGGAGGG + Intergenic
946790299 2:223293918-223293940 GACTGCAAGCAGAAGCAGGGTGG - Intergenic
946858316 2:223975676-223975698 GAGGGAAAAAACAAGCAGGATGG - Exonic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947275876 2:228391217-228391239 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
948185807 2:236020425-236020447 GACAGCAAATGGAAGCAGGAGGG - Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948572962 2:238928883-238928905 GAAACCAAACAGAACCAGCAGGG + Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1169275245 20:4229398-4229420 GAGAAAAAAATGAAGCAGGAAGG + Intronic
1169928272 20:10805759-10805781 AAGAGCAGCCAGAAGCAGGCAGG - Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170229480 20:14028717-14028739 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1170294155 20:14806299-14806321 GAGGGCGACCAGAAGCAGGGTGG + Intronic
1170761050 20:19251865-19251887 GAGAGCACACAGATACTGGAGGG - Intronic
1170884903 20:20331905-20331927 GAGAGCAGACAGGCACAGGAAGG + Intronic
1171081795 20:22194276-22194298 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1171789110 20:29502209-29502231 GATAGCAAAAAGAAGAAGGGAGG + Intergenic
1172466688 20:35160788-35160810 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1173235049 20:41237564-41237586 GAGAACACACAGACACAGGAAGG + Intronic
1173776577 20:45713826-45713848 GAGAGCGAAGAAAAGCAGGGTGG + Intergenic
1174655576 20:52169545-52169567 GAGAGCAGAAAGTGGCAGGAGGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175127349 20:56762461-56762483 GGGAGCACACAGGAGCAGAAGGG - Intergenic
1175456604 20:59120097-59120119 GAGAGCAAAAAGAGGGATGATGG + Intergenic
1176327169 21:5510753-5510775 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176400588 21:6310198-6310220 GAAGTCAAACAGAAGCAGGTGGG - Intergenic
1176436569 21:6678906-6678928 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176460831 21:7005976-7005998 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176484392 21:7387754-7387776 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1176996060 21:15556681-15556703 GAGAACACACGGACGCAGGAAGG + Intergenic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177313154 21:19423999-19424021 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177540911 21:22493315-22493337 GCGGGCAAGCAGAAGCAGGGTGG + Intergenic
1178258626 21:31078170-31078192 GACAGCAACCAGAAGCCAGAGGG + Intergenic
1178450344 21:32692642-32692664 GAAAGCACACAGGAGAAGGAAGG + Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1178976746 21:37227129-37227151 GTGAGCGCTCAGAAGCAGGAAGG - Intronic
1179085228 21:38210542-38210564 CACAGCAACCAGAAGCTGGAAGG - Intronic
1179249801 21:39663389-39663411 AAGAACACACAGAAGCAGTAGGG - Exonic
1179376867 21:40857465-40857487 TAGAACAAAAAGAAGAAGGAAGG - Intergenic
1179676883 21:42989078-42989100 GACATCAAACAGAAAAAGGAAGG - Intronic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1181862622 22:25830647-25830669 GAGAGCAAACAGAAGCGTGCAGG + Intronic
1182057727 22:27373196-27373218 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184946979 22:47810780-47810802 GAGGGAAAAGGGAAGCAGGAGGG - Intergenic
1185152607 22:49173442-49173464 GAGAGCAAAGATAAGCATGCTGG - Intergenic
949154923 3:816344-816366 GAGGGCAAGCCAAAGCAGGATGG + Intergenic
949395025 3:3605612-3605634 GAGAACCAACTGAAGCATGAGGG + Intergenic
949580682 3:5384534-5384556 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950467217 3:13162604-13162626 GTCAGCAAAAAGAAGCAGGAAGG - Intergenic
950562064 3:13736680-13736702 GAGGGCAAGCCGAAGCAGGTTGG - Intergenic
950748257 3:15108061-15108083 AAGAGCAAACAGGTGCATGAAGG - Intergenic
950753877 3:15155952-15155974 GGGAGAAAAGAGAAGTAGGAAGG + Intergenic
951310820 3:21124694-21124716 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
951347322 3:21561441-21561463 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
952136039 3:30421140-30421162 GAGAGCAATCAGTAGTAGAATGG - Intergenic
952531038 3:34262281-34262303 GAGAGGAAACAGACTCAAGAAGG - Intergenic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
953047153 3:39304373-39304395 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953219097 3:40951243-40951265 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
953222376 3:40984566-40984588 GAAAGCTATCATAAGCAGGAAGG - Intergenic
953226596 3:41027185-41027207 GACAGCACAAAGAGGCAGGAAGG + Intergenic
953502809 3:43454419-43454441 GAGACCAGACAAAAGCAGAAGGG + Intronic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
953653157 3:44823984-44824006 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954507566 3:51091852-51091874 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955365829 3:58309101-58309123 GAGAGCAGGCAGACACAGGATGG + Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955806204 3:62737673-62737695 GAGACCAAACAGAAACGGAAAGG - Intronic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957146591 3:76432834-76432856 GAGAGAAAAAAGAGGAAGGAAGG + Intronic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957613722 3:82502437-82502459 AGGAGAAAACAAAAGCAGGAAGG + Intergenic
957624250 3:82638951-82638973 GAGAGCATGAAGAAGCAGTATGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958257512 3:91341516-91341538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
958739998 3:98057649-98057671 GAGAGCAAAGGGAAGCAGTCAGG + Intergenic
959045254 3:101466855-101466877 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959494869 3:107038496-107038518 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
959734897 3:109647734-109647756 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
959847993 3:111056503-111056525 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
960335405 3:116411577-116411599 GAGAACACACAGACACAGGAAGG + Intronic
960602025 3:119468397-119468419 GAGAGCAGACAAAACCAGAATGG - Intronic
960610504 3:119550942-119550964 GAGACTAAAGAGTAGCAGGATGG - Intronic
960653888 3:119981368-119981390 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
961157236 3:124690517-124690539 GAGAGCAAAGATAAGCAGGTAGG + Intronic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961314687 3:126026486-126026508 GACAGAAATCAGAAGCATGAAGG + Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962181131 3:133207278-133207300 GAAGGCAAGCAGAAGCAGGGTGG - Intronic
962628643 3:137252937-137252959 GAGAACACACAGACACAGGAAGG + Intergenic
962634856 3:137319879-137319901 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
962991475 3:140581203-140581225 GAGAGCAAACAGGAGCACTAGGG - Intergenic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963481515 3:145879976-145879998 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963980150 3:151528549-151528571 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964264686 3:154880937-154880959 GAGAACAAACGGACACAGGAAGG + Intergenic
964371447 3:156004381-156004403 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
964649188 3:158991866-158991888 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
965091161 3:164163727-164163749 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965253290 3:166369511-166369533 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
965391154 3:168106021-168106043 GACAGGAAACAAAAGCAGCAAGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965698173 3:171431052-171431074 AAGAGCCAAAACAAGCAGGACGG - Intronic
965773092 3:172201291-172201313 GAGAGCAGCCAGAAGCAGGGTGG - Intronic
966210918 3:177452482-177452504 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
966250997 3:177865570-177865592 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
966255005 3:177907976-177907998 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966474938 3:180333843-180333865 GAGAACATACAGACACAGGAAGG + Intergenic
966477537 3:180367498-180367520 GAGAGCAAGCCAAAGCAGGGTGG + Intergenic
966744160 3:183259835-183259857 GAGACCAAGAAGAAGAAGGAGGG + Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967978389 3:195048319-195048341 GGGTGAAAACAGAAGCAGGCAGG + Intergenic
968860693 4:3166911-3166933 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969899013 4:10331241-10331263 GAGAACACACAGACACAGGAAGG - Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970652737 4:18196511-18196533 GAAAGCAAAAAGAAGAGGGAAGG - Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970714643 4:18907607-18907629 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
970975766 4:22041160-22041182 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971336448 4:25727906-25727928 GAGGGCCCACAGAATCAGGAAGG - Intergenic
971749121 4:30623873-30623895 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
972191580 4:36598540-36598562 GAAAGGAAACAGAAGAAGGTAGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972374661 4:38459225-38459247 GGGAGCAAAAAGGAGAAGGAAGG + Intergenic
972743362 4:41909810-41909832 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
972860902 4:43168657-43168679 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973715303 4:53670108-53670130 GAGGGCAAACTGAAGCAGCGTGG - Intronic
973786890 4:54340734-54340756 GAGATCAAACAGCATCAGAATGG + Intergenic
974251862 4:59394798-59394820 GAGGGCCAGCAGAAGCAGGTTGG - Intergenic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974265823 4:59584541-59584563 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
974566865 4:63589749-63589771 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
974792924 4:66713738-66713760 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
974814770 4:66989781-66989803 GAGAGCCAGCAGAACCAGGGTGG - Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975291152 4:72679481-72679503 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975572558 4:75832752-75832774 AAGAGCCACCAGAAGCAGAAAGG + Intergenic
975631428 4:76407655-76407677 GAGATCAATCAGAAGCATAAAGG + Intronic
975844066 4:78506723-78506745 GAGGGCAAGCTGAAGCAGGGAGG - Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
977039729 4:92001637-92001659 GAGAGCAAGAAGAAGCAGGGTGG + Intergenic
977326517 4:95580771-95580793 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
977359399 4:95983657-95983679 AAGAGGAAACAGTGGCAGGAAGG + Intergenic
977509112 4:97938747-97938769 GAGAGCAATGAAAAGCAGGGTGG - Intronic
977561431 4:98537286-98537308 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
978078964 4:104568444-104568466 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979022949 4:115525565-115525587 GAGAGCAAGTAGAAGCAGGGTGG - Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979179413 4:117707162-117707184 GAGAACAAAGAAAAGCAGGAGGG + Intergenic
979416891 4:120452429-120452451 GAGAGGGAAAAGAAGGAGGAAGG + Intergenic
979417372 4:120460483-120460505 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979441958 4:120760637-120760659 AGGAACAAACAGAAGCATGATGG + Intronic
979668362 4:123336990-123337012 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
979966070 4:127077635-127077657 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980157718 4:129126815-129126837 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980512395 4:133811962-133811984 GAAAGCAAACAAAAGCAGGGTGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980612083 4:135172615-135172637 GGGAGCAAAGAGCAGGAGGATGG + Intergenic
980634009 4:135474256-135474278 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980733316 4:136849253-136849275 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980855154 4:138431285-138431307 GACAGCAAGCAGCAGCAGGGTGG + Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981064685 4:140470117-140470139 AAGAGCACACAGCAGCGGGAAGG - Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981141055 4:141269762-141269784 GAGAGCACATGGACGCAGGAAGG - Intergenic
981428000 4:144626070-144626092 GAGAGCAAACAAAAGAAAAATGG + Intergenic
981629622 4:146804092-146804114 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
981939843 4:150271052-150271074 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
982060456 4:151599441-151599463 GAGAGAAAATAGGAGCAAGATGG + Intronic
982323790 4:154108627-154108649 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
982529422 4:156520635-156520657 GAAAACAAAGAGGAGCAGGATGG + Intergenic
982719942 4:158849020-158849042 GAGATCAAGAAGAATCAGGATGG - Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983047563 4:163005016-163005038 GAGGGCAAGCCGAAGCAGGATGG - Intergenic
983543207 4:168935121-168935143 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
984354113 4:178636826-178636848 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984618551 4:181926857-181926879 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985477316 5:85486-85508 GCGAGCAGACATACGCAGGAGGG + Intergenic
985786113 5:1895925-1895947 GAGAGAAAACACCACCAGGAAGG - Intergenic
985816481 5:2131803-2131825 GAGCGGAAACAGAGGCAGCATGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986002880 5:3643778-3643800 AGGAGGAAACAGCAGCAGGAGGG + Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986378915 5:7163097-7163119 GATGGCCAACAGAAGCAGGGTGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986947360 5:13039283-13039305 GAGAGAAAAAAGAAGTAGGTAGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987075664 5:14379845-14379867 GACAGTGAACAGAAGCAGAACGG - Intronic
987187902 5:15444123-15444145 GTCAGGAGACAGAAGCAGGAGGG - Intergenic
987781363 5:22440591-22440613 TAGAGCAACCAGAACAAGGATGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988186493 5:27870926-27870948 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988402023 5:30775282-30775304 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
988867776 5:35354339-35354361 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
988975143 5:36508164-36508186 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
989320795 5:40131346-40131368 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
989682674 5:44047104-44047126 GAGAGCAAGGAAAAGCAGGATGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
989999417 5:50875497-50875519 GAGAACACACAGACACAGGAAGG - Intergenic
990160020 5:52927552-52927574 GAAAGCAAACAGAATCAGAGTGG - Intronic
990231050 5:53712981-53713003 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
990239153 5:53799519-53799541 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
990332919 5:54745214-54745236 GAGGGCAAACAGAACCAGTAGGG + Intergenic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
990940831 5:61201094-61201116 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
991236617 5:64406809-64406831 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
991280811 5:64910924-64910946 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
992025992 5:72669619-72669641 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
993145327 5:84086448-84086470 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
993266402 5:85732009-85732031 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
993301969 5:86222997-86223019 GATAGAAAACAGAGGCTGGAAGG + Intergenic
993381946 5:87218163-87218185 GAAGGCAAGCAGAAGCAGGGTGG - Intergenic
993410563 5:87567817-87567839 GAGGGCAAGCAGAAGCAAGGGGG - Intergenic
993431983 5:87842964-87842986 GAGAGCTAACAGCAGTAGGAAGG - Intergenic
994141668 5:96348231-96348253 GAAAGGTAACAGAAGAAGGAAGG + Intergenic
994204359 5:97017416-97017438 GAGAGTAAAAAAAAGCAAGATGG - Intronic
994302722 5:98165079-98165101 GAAAGGAAGCAGAAGCAGAAGGG - Intergenic
994470874 5:100204391-100204413 GAGAAAAAACAGAGCCAGGAGGG + Intergenic
995052131 5:107719115-107719137 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
995093990 5:108213583-108213605 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
995264288 5:110139526-110139548 GAGAGCAAGGAAAAGCAGCATGG - Intergenic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995656838 5:114435155-114435177 GAGAGAAAACAAACTCAGGAAGG - Intronic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996295113 5:121904310-121904332 GAGAGAAAAAAGAAACAGGAAGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996638962 5:125729982-125730004 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
996828981 5:127719055-127719077 GATGGCTAACAGAAGCTGGAAGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
996987581 5:129585192-129585214 GAGGGCAAGCAGAAGCGGGCAGG - Intronic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997343934 5:133171198-133171220 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
997593070 5:135087352-135087374 AAGAGCAAGCAGAAGCAAGGAGG + Intronic
998198346 5:140096426-140096448 CAGAGCTAAAAGGAGCAGGAGGG + Intergenic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998630511 5:143892882-143892904 CAGAGCTAACAGAAACAGCAAGG - Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999257532 5:150217904-150217926 GAGAGAAGACAGTAGCTGGAAGG + Intronic
999365056 5:151017995-151018017 GAGGGCAATCAGAAGCAGCCTGG + Intergenic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999524162 5:152384154-152384176 GAAAGGAAAGAGAAGAAGGAAGG - Intergenic
999556730 5:152751813-152751835 TGGAGCAAGCAGAAGCAGGGTGG + Intergenic
999623105 5:153491725-153491747 GAGAGCCAACAGGAGGAGAAAGG - Intronic
999868235 5:155725254-155725276 GAGAGCAAGCTGAGGAAGGATGG - Intergenic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000547977 5:162625556-162625578 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1000820269 5:165973952-165973974 GAGGGCAACGAGAAGCAGGGTGG - Intergenic
1000996186 5:167960994-167961016 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1002629235 5:180558603-180558625 AAAAGCAAACACAAGAAGGAAGG - Intronic
1002801086 6:522131-522153 GAGAGGAGACACAAGCAGGAGGG + Intronic
1003024059 6:2537753-2537775 TTGAGAAAACAGAAGCAGAAAGG - Intergenic
1003167841 6:3696905-3696927 GAGATGGAAGAGAAGCAGGAAGG + Intergenic
1003850658 6:10219129-10219151 GAGAGGAAAGAGGAGAAGGAGGG - Intergenic
1003906854 6:10708721-10708743 GAGAACACACAGACACAGGAAGG - Intronic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004700931 6:18078873-18078895 TGGAGAAAACAGAAACAGGAAGG + Intergenic
1005125480 6:22442220-22442242 GAAAAAAAGCAGAAGCAGGAAGG + Intergenic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1006197686 6:32255824-32255846 GAGAACAAAGAAAAGCTGGATGG - Intergenic
1006198466 6:32263590-32263612 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1006434972 6:34021380-34021402 TGGAGCCAACACAAGCAGGAGGG + Intronic
1006972869 6:38065016-38065038 GAGAGCAAAGAAAAGCAGGGAGG + Intronic
1006992309 6:38225756-38225778 GAGAGGAAAAAGAAGCATCAGGG + Intronic
1007745868 6:44042661-44042683 GAGAGCAACCAGAGGAGGGAGGG + Intergenic
1007858049 6:44878770-44878792 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1008082529 6:47209529-47209551 GAAAGCAAGAAAAAGCAGGATGG + Intergenic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008782813 6:55127367-55127389 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1008896920 6:56566493-56566515 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1008997793 6:57679507-57679529 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009186285 6:60578845-60578867 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009335972 6:62491866-62491888 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009536589 6:64896279-64896301 GAGGGCAAGCAGATGCAGGGTGG + Intronic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1009880428 6:69560310-69560332 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1009950252 6:70387147-70387169 AAGAGCAAAAAGAAGCAGGGAGG - Intergenic
1009998202 6:70920394-70920416 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010276257 6:73971966-73971988 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1010772257 6:79845364-79845386 GGGAGCAGAGAAAAGCAGGAGGG - Intergenic
1010935956 6:81861623-81861645 GTGCTCACACAGAAGCAGGAAGG + Intergenic
1011010727 6:82701231-82701253 AAAAGAAAAAAGAAGCAGGAAGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011065417 6:83320999-83321021 GAGGGCAAGGAGAAGCAGGGTGG + Intronic
1011137489 6:84115874-84115896 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1011754142 6:90482194-90482216 TTAAGAAAACAGAAGCAGGAAGG - Intergenic
1011798596 6:90983759-90983781 TGGAGCCACCAGAAGCAGGAAGG - Intergenic
1011882951 6:92053485-92053507 GAGAAGAAAAAGAAGCAGGAGGG + Intergenic
1012074869 6:94670863-94670885 AAGAACAAACAAATGCAGGAAGG + Intergenic
1012243924 6:96904972-96904994 GAAAGCAAACTGATGCAGCAGGG - Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012870803 6:104670927-104670949 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1012922495 6:105234284-105234306 GAGAGCAAGCAGAAACAGGGTGG - Intergenic
1013672543 6:112421241-112421263 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1013939506 6:115644994-115645016 GAGTGCGAGCAGAAGCAGGGTGG + Intergenic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1014352255 6:120359877-120359899 TAGATCAAGCAGAAGAAGGATGG + Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014564487 6:122930919-122930941 GAGAACAAAGAAAAGCAGGTGGG - Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1014922347 6:127228332-127228354 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1015419158 6:132986442-132986464 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1015533532 6:134244610-134244632 GAGGGCGAGCAGAAGCAGGTGGG - Intronic
1015616135 6:135077219-135077241 GGTAGCAAACAAAAGCAAGATGG - Intronic
1015829164 6:137348976-137348998 GAGAGCAAAAGGAAGCAGAGTGG + Intergenic
1016019757 6:139224247-139224269 GAGAACACACAGACACAGGAAGG + Intergenic
1016060577 6:139625737-139625759 GAGAGGACCCTGAAGCAGGAAGG - Intergenic
1016111383 6:140229983-140230005 GAGGGCGAGCCGAAGCAGGATGG + Intergenic
1016436919 6:144047169-144047191 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018899022 6:168041999-168042021 GGGAGCAAACAGAGGCAGGAAGG + Exonic
1019020706 6:168915301-168915323 GACAGCAGAGAGCAGCAGGAGGG + Intergenic
1019595400 7:1856170-1856192 GAGAGGCGTCAGAAGCAGGAGGG - Intronic
1019797571 7:3063157-3063179 CAGAGCAAACACAAGCTAGAAGG + Intergenic
1019988034 7:4672450-4672472 GAGAGCAAAGAGAAGCCACAAGG + Intergenic
1020002994 7:4766158-4766180 GAAAGCAAGCAGAAGAGGGATGG - Exonic
1020333315 7:7041978-7042000 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020391501 7:7662610-7662632 GAGGGCGAACAGAAACAGGGTGG - Intronic
1020487749 7:8739442-8739464 GAAGGCAATCAGAAGCAGGGTGG - Intronic
1020569753 7:9844695-9844717 GAGAACACACAGACACAGGAAGG + Intergenic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1020874353 7:13674313-13674335 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021749429 7:23780132-23780154 GAGGGCAAGCAAAAGCAGGGTGG - Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022420459 7:30216160-30216182 GAGAGGAAAGAAAAGAAGGAAGG + Intergenic
1022809882 7:33858471-33858493 GTGAGCTACCAGAAGCTGGAAGG + Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023404708 7:39820617-39820639 AAGAGCAAAGAGCAGCAGGTCGG + Intergenic
1023705910 7:42941664-42941686 GAGAGCAAACTGACCCAGGGCGG - Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024034474 7:45495579-45495601 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1024378744 7:48669780-48669802 CAGATCAAACATGAGCAGGAAGG + Intergenic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024813812 7:53244352-53244374 GAGAACACACAGACACAGGAAGG - Intergenic
1025638006 7:63340408-63340430 GAGGGCGAGCAGAAGCAGGTTGG - Intergenic
1025644690 7:63407691-63407713 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026511930 7:71034536-71034558 GAGAGCAAAGTGAAGAAGCAGGG - Intergenic
1026981460 7:74529151-74529173 GGGAGCACACAGAGGCATGAAGG + Intronic
1026996091 7:74617619-74617641 GAGAGGAAATAGGAGCAGGGAGG - Intergenic
1027790311 7:82633242-82633264 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028080266 7:86567202-86567224 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1028210542 7:88069071-88069093 GAGCACACACAGAAGCAAGAGGG - Intronic
1028396072 7:90369791-90369813 GAGGGCAAACCAAAGCAGGGTGG - Intronic
1028627141 7:92889677-92889699 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1028692094 7:93664008-93664030 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1028714482 7:93948892-93948914 GAGAGAAAAAGGAAGAAGGAAGG + Intergenic
1028998447 7:97127095-97127117 GAGGGCGAGCAGAAGCAGCATGG - Intronic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1030781053 7:113600590-113600612 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1031323677 7:120365168-120365190 GGGAGCAAAGAGAGGAAGGAAGG + Intronic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031717379 7:125125515-125125537 GAGGGCGAGCAGAAGCAGGCTGG - Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032464417 7:132134846-132134868 GAAAGCAAAATGAAACAGGAAGG - Intronic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1032966369 7:137103246-137103268 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
1033683939 7:143621941-143621963 GACTGCATATAGAAGCAGGAGGG + Intronic
1033687115 7:143701130-143701152 GACTGCATATAGAAGCAGGAGGG + Intronic
1033700673 7:143835697-143835719 GACTGCATATAGAAGCAGGAGGG - Intergenic
1033733233 7:144198059-144198081 GAGAACCAACTGAAGCTGGAGGG - Intergenic
1033749817 7:144352928-144352950 GAGAACCAACTGAAGCTGGAGGG + Intergenic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034521738 7:151625760-151625782 GAAAACAAACCGAAGAAGGAAGG + Intronic
1034998777 7:155594981-155595003 GAAATCACACAGAGGCAGGAGGG + Intergenic
1035117456 7:156536600-156536622 GAGAGGGAGCAGGAGCAGGAGGG + Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036215667 8:6877825-6877847 GAGAGTAAACAGCAGAAGGTAGG + Exonic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037249662 8:16877457-16877479 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1038050674 8:23807576-23807598 GAAAGCAAAGAGAAGCAGGAAGG + Intergenic
1038934764 8:32236732-32236754 GAGAGGAGAAAGAGGCAGGAAGG + Intronic
1038978462 8:32728498-32728520 GACAACAAAGAGAAGCAGAAGGG + Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039754911 8:40512728-40512750 GAGAACAAGCTGAAGCAGGGTGG - Intergenic
1039832336 8:41225149-41225171 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040384026 8:46901067-46901089 GAGAGAAACCTGAAGTAGGAGGG - Intergenic
1040473012 8:47752132-47752154 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1040779815 8:51094823-51094845 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1041019507 8:53624220-53624242 GAAAGCAGACAGAAGCAGACAGG + Intergenic
1041148219 8:54902588-54902610 TAGACCAAACAGTACCAGGAAGG + Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041164396 8:55076753-55076775 CACAGCAAACAGATTCAGGATGG + Intergenic
1041165794 8:55090995-55091017 AGGAGCACCCAGAAGCAGGAGGG + Intergenic
1041287222 8:56273386-56273408 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042420991 8:68589420-68589442 GAGAGAAAATAAAAGAAGGAAGG + Intronic
1042614295 8:70631862-70631884 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1042622799 8:70724671-70724693 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1042773537 8:72404951-72404973 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1042813927 8:72857223-72857245 GAGAGCTTTTAGAAGCAGGATGG + Intronic
1042946110 8:74156350-74156372 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043165883 8:76902067-76902089 GAGGGCAAGCGGAAGCAGGGTGG - Intergenic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1043703535 8:83321616-83321638 GAGGGCGAGTAGAAGCAGGATGG + Intergenic
1044405189 8:91818602-91818624 GGAGGCAAGCAGAAGCAGGATGG + Intergenic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1044577010 8:93780341-93780363 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044879414 8:96707842-96707864 GACAGCATTCAGAAGCTGGAAGG - Intronic
1044948193 8:97410786-97410808 GCGAGCAAACAGTTGGAGGAGGG - Intergenic
1045123365 8:99063241-99063263 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
1045315472 8:101040257-101040279 CAGAGCCACCAGAAGCTGGAAGG - Intergenic
1045511218 8:102813323-102813345 GATAGCCAACAGGAACAGGAAGG + Intergenic
1045650324 8:104336279-104336301 GAGAGCCAAGAGAAGCCAGAGGG - Intronic
1045973258 8:108103627-108103649 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1046048058 8:108986856-108986878 GAGGGCAAGCAGAATCAGGGTGG - Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046860279 8:119083672-119083694 GATAGGAAACTAAAGCAGGAAGG + Intronic
1047063463 8:121253461-121253483 GAGAGCCACAAGAAGCCGGAAGG - Intergenic
1047549061 8:125850070-125850092 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
1047829823 8:128617106-128617128 GGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1047931513 8:129732831-129732853 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048358434 8:133673451-133673473 GAGTGCAAACAAGAGCAGGCTGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048819066 8:138363120-138363142 GAGAGCAAAAAGAAACTGGGAGG + Intronic
1049070373 8:140351023-140351045 GCGAGAAAGCAGAAGCAGGCTGG + Intronic
1049071873 8:140361858-140361880 GCGAGCAAACAGAACAAGAAGGG + Intronic
1049356803 8:142193074-142193096 GGGAGGAAAAAGGAGCAGGAGGG + Intergenic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1050031680 9:1393250-1393272 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1050286512 9:4108358-4108380 GAGAGCAAAAATAAGGAGCAAGG + Intronic
1050591115 9:7161302-7161324 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050604200 9:7283676-7283698 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050963256 9:11765413-11765435 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051459529 9:17295475-17295497 GAGAGCAAGGAAAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051748203 9:20315723-20315745 GGGAGCACACAGGACCAGGATGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1053008752 9:34621584-34621606 GAGGGCAAAAACAAGCAGGAGGG + Intronic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1055061345 9:72072342-72072364 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1055116608 9:72612010-72612032 AAATCCAAACAGAAGCAGGAGGG - Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055210237 9:73782887-73782909 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1055343447 9:75309351-75309373 GAGAGCAAAGAAAAGCAGGATGG - Intergenic
1055453563 9:76453005-76453027 GAAAGCAGACTGAAGCAGCAGGG - Intronic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056193657 9:84208661-84208683 GAGACCCAACAGAAGCTGCAAGG - Intergenic
1056212661 9:84379671-84379693 GAAAGAAAAAAGAAGAAGGAAGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1058074664 9:100638266-100638288 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058200266 9:102029231-102029253 GAGAACGAAGAAAAGCAGGATGG - Intergenic
1058554987 9:106157648-106157670 GAGAGCGAGCAGAACAAGGATGG + Intergenic
1058984722 9:110200113-110200135 GAGAGAAAAGATAGGCAGGAAGG + Exonic
1059789013 9:117619670-117619692 CAGATCAAACAGAAACAGGCAGG + Intergenic
1059864712 9:118501486-118501508 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1059910515 9:119038629-119038651 GAGAACACACAGACACAGGAAGG - Intergenic
1060698618 9:125731392-125731414 GAGAGGAAAAGGAAGCAGGAGGG - Intergenic
1060821994 9:126666462-126666484 AAGAGGAAAGGGAAGCAGGAAGG + Intronic
1061786438 9:133031305-133031327 GAGAGCCAACAGAACAAAGAAGG + Intronic
1061920190 9:133778424-133778446 GAGACACAACAGAGGCAGGAAGG + Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062009982 9:134261715-134261737 GAGAGACAATAGAAACAGGAGGG + Intergenic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203434943 Un_GL000195v1:129753-129775 GAAGTCAAACAGAAGCAGGTGGG - Intergenic
1185961015 X:4545799-4545821 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186230828 X:7451687-7451709 GAGAACAAACGGACACAGGAAGG - Intergenic
1186332833 X:8554292-8554314 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1186598981 X:11015854-11015876 GAGAGCACACAATAGCTGGATGG + Intergenic
1186679728 X:11859711-11859733 AACAAAAAACAGAAGCAGGATGG - Intergenic
1186695050 X:12021594-12021616 GGGAGCAGATAGAAGCAGGCAGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1187478046 X:19629198-19629220 GTGAGGACACATAAGCAGGAGGG + Intronic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187645994 X:21348147-21348169 GAGAACAAAGAAAAGCAGGGTGG + Intergenic
1187705457 X:22005425-22005447 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1187823311 X:23311136-23311158 GAGAACAAATAGCAGCAAGAGGG - Intergenic
1188130097 X:26420061-26420083 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1188280605 X:28263224-28263246 GAGAACACACAGACGTAGGAAGG - Intergenic
1188468982 X:30515926-30515948 GAGAGAAGAGAGAAGCAAGAGGG - Intergenic
1188744954 X:33830126-33830148 GAGAGCAATAAAAAGCAGGGTGG - Intergenic
1188817875 X:34737802-34737824 CAAAGCTAACAGAAGCCGGAAGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1188997423 X:36903265-36903287 GAGTGCAATCAGCACCAGGAAGG + Intergenic
1189363481 X:40370660-40370682 AGGAGCAACCAGAAGCAGGAAGG + Intergenic
1189604714 X:42664510-42664532 GAGAGGAATAAGAAACAGGAAGG + Intergenic
1189751961 X:44231455-44231477 GAGAGCGAAAGGAAGGAGGAGGG - Intronic
1189940232 X:46113307-46113329 GAGAGCAAGGAAAAGCAGAATGG - Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190505792 X:51125074-51125096 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1190959850 X:55235116-55235138 GAGGGCAAGCAGAATCAGGGTGG - Intronic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191115334 X:56846582-56846604 GAGGGCAAGCAGAAACAGGGTGG + Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191194346 X:57705526-57705548 GTGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191627262 X:63282812-63282834 GAGAAAAAACAGAAGCACCAAGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191733441 X:64363760-64363782 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1192131474 X:68555602-68555624 AAAAGTAAACAGTAGCAGGAGGG - Intergenic
1192349253 X:70342627-70342649 GAGAGCACACTGATGCATGAAGG - Intronic
1192451695 X:71248854-71248876 GAGAGCACACAGAAGGTGTAAGG + Intronic
1192712695 X:73607784-73607806 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1192712927 X:73610363-73610385 GAGAGCGAGCAGAAGCACGGTGG - Intronic
1192806338 X:74512798-74512820 GAGGGCCAACAGATCCAGGATGG + Intronic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1192975594 X:76280729-76280751 GAGAGCAAATGGACACAGGAAGG - Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193065357 X:77253906-77253928 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1193161454 X:78233352-78233374 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1193190456 X:78564041-78564063 TAGAGCAAGGAAAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193258658 X:79379852-79379874 AAGAGCGAAGAGAAGCAGGGTGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193382252 X:80828472-80828494 GAGGGCAAGCAGAAACAGGGTGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194177145 X:90664990-90665012 GAGAGCAAGGAAAAGCAGGATGG + Intergenic
1194182793 X:90734655-90734677 GAAAGCAGCCAGAAGCAGGGGGG + Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1194576431 X:95619228-95619250 GAGGGCAAGCCAAAGCAGGATGG - Intergenic
1194597959 X:95882612-95882634 GAGAGAGGACAGTAGCAGGAGGG - Intergenic
1194624701 X:96214352-96214374 GAGGGCAAGATGAAGCAGGATGG + Intergenic
1194708039 X:97200049-97200071 GAGAGTGAGCACAAGCAGGATGG + Intronic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1194954499 X:100162856-100162878 GAGGGCAAGCAGAAGCGGGGTGG - Intergenic
1194963921 X:100266673-100266695 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195345041 X:103941006-103941028 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1195351272 X:103998711-103998733 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1195434774 X:104829425-104829447 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195510348 X:105709171-105709193 CAGAGCCAACAGAAGCAGCCAGG + Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195812573 X:108851063-108851085 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1196281265 X:113825811-113825833 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1196284602 X:113864303-113864325 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1196312301 X:114183328-114183350 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1196351294 X:114733617-114733639 GAAAGGAAAAAGAAGCAAGAGGG + Intronic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1196381708 X:115098372-115098394 GAGAGCAAGAAAAAGCAGGGTGG + Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197160220 X:123314380-123314402 GATACCAAACAGAAACATGAAGG + Intronic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197395676 X:125923625-125923647 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1197455102 X:126669988-126670010 GAAAACAAAGAAAAGCAGGATGG + Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197521297 X:127500665-127500687 GAGAGAAAATAGAAGCCGGAAGG + Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1197906161 X:131428110-131428132 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1198002358 X:132451964-132451986 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198062520 X:133061646-133061668 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1198072014 X:133158903-133158925 GAGGGCAAGCCGAAGCAGGCTGG + Intergenic
1198678665 X:139157952-139157974 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1199035914 X:143050792-143050814 GAGAGTGAACATAAGCAGGGTGG - Intergenic
1199401537 X:147405126-147405148 GATAACGAACAGAAGCAGGGTGG + Intergenic
1199499963 X:148498268-148498290 GAGATCAAAACCAAGCAGGAAGG - Intergenic
1199524976 X:148781980-148782002 GATGGCGAGCAGAAGCAGGATGG - Intronic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1199680459 X:150220905-150220927 CAGAGCCACCAGAAGCTGGAGGG - Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1200081390 X:153578505-153578527 GGGAGCAAAGAGAGGCAGCAAGG + Intronic
1200523818 Y:4247135-4247157 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1200529412 Y:4316610-4316632 GAAAGCAGCCAGAAGCAGGGGGG + Intergenic
1200725187 Y:6661221-6661243 GAGAGAAAAAAAAAACAGGATGG - Intergenic
1200740347 Y:6847096-6847118 GAGAGCAAGCAGGAGCAGGGTGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201537751 Y:15069237-15069259 AAGTGCAAGCAGAAGCAGGTGGG + Intergenic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201794344 Y:17878678-17878700 GAGATCACAAAGAGGCAGGATGG + Exonic
1201807210 Y:18027307-18027329 GAGATCACAAAGAGGCAGGATGG - Exonic
1201946313 Y:19514661-19514683 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1201984665 Y:19952844-19952866 GAGAACACACAGACACAGGAAGG + Intergenic
1202355724 Y:24046477-24046499 GAGATCACAAAGAGGCAGGATGG + Exonic
1202515054 Y:25623632-25623654 GAGATCACAAAGAGGCAGGATGG - Exonic