ID: 1048196409

View in Genome Browser
Species Human (GRCh38)
Location 8:132335401-132335423
Sequence CAGTGAGACTGGAGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 7, 3: 86, 4: 627}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048196409_1048196415 26 Left 1048196409 8:132335401-132335423 CCAACTTCTCTCCAGTCTCACTG 0: 1
1: 0
2: 7
3: 86
4: 627
Right 1048196415 8:132335450-132335472 CTTTGTAATAAGTATTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048196409 Original CRISPR CAGTGAGACTGGAGAGAAGT TGG (reversed) Intronic
900423430 1:2565418-2565440 GAGGGAGAGGGGAGAGAAGTGGG + Intergenic
900830737 1:4963555-4963577 CAGTAAGACTGGGGAGCAGGGGG - Intergenic
900914411 1:5624858-5624880 CAGTAACACAGGAGAAAAGTGGG + Intergenic
900926664 1:5710316-5710338 CTGAGAGACTGGAAAGAAGGAGG + Intergenic
901376185 1:8841191-8841213 CAATGAGGCTGGAGAACAGTGGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902711234 1:18241386-18241408 CAGAGAGCCTTGAGAGAAGGAGG + Intronic
903016938 1:20367305-20367327 CGGTGGGACTGGGGAGATGTAGG - Intergenic
904090362 1:27940856-27940878 GAGTGAGACTGGGGAGGTGTGGG - Intronic
904197571 1:28797193-28797215 GAGAGAGACAGGAGAGAAGCGGG - Intergenic
904275808 1:29383497-29383519 CAGTGAGACTGAAGAGATGGGGG - Intergenic
905896941 1:41554095-41554117 CAGGGAGAATGGAAACAAGTTGG - Intronic
905968315 1:42117825-42117847 CACTGAAACTGGAGAACAGTGGG + Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906218100 1:44056204-44056226 TAGTGAGGCTGGAGAGTAATAGG - Intergenic
906254860 1:44340595-44340617 CAGTGAGTCAGGAGAGAGATGGG - Intronic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907600286 1:55761912-55761934 CAGGGAGAATGGAGTCAAGTTGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908427898 1:64026134-64026156 GAGTGAGAATGAAGACAAGTTGG - Intronic
908757117 1:67479311-67479333 CAGTGAGAGTGGAGTGAGGGAGG + Intergenic
908771903 1:67605127-67605149 CAATGAGCCAGGAGAGAAGGAGG - Intergenic
908876721 1:68686095-68686117 CAGAGAGAATGGAAACAAGTTGG - Intergenic
908969318 1:69807895-69807917 CAGGGAGAATGGAGCCAAGTTGG - Intronic
909008023 1:70300185-70300207 AAATGAGAATGAAGAGAAGTTGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910438185 1:87226634-87226656 GAGGGAAACTGGAGAGAGGTGGG + Intergenic
910642159 1:89474781-89474803 CAGTGAGAATGGAACCAAGTTGG + Intergenic
910827668 1:91427042-91427064 CAGGGAGAATGGAATGAAGTTGG - Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911632821 1:100201447-100201469 CAGGGAGAATGGAAACAAGTTGG + Intronic
912406018 1:109438266-109438288 CATTGATAGTGAAGAGAAGTGGG - Intergenic
912592583 1:110840341-110840363 TGGTGAGAATGTAGAGAAGTTGG + Intergenic
913933454 1:125009136-125009158 CAGGGAGAATGGAAACAAGTTGG + Intergenic
914915382 1:151816140-151816162 CAGGGAGACTGGTGAGGAGGTGG + Intronic
915457524 1:156050819-156050841 CTGTGAGTCTGGGGAAAAGTTGG - Intronic
915644181 1:157255468-157255490 CAGGGAGAATGGAAACAAGTTGG + Intergenic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915924408 1:160004991-160005013 CAGTGAGCCTGGAGAGACCTTGG - Intergenic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
916747667 1:167697156-167697178 CAGTCAGACTGTGGAGAACTTGG + Exonic
917633886 1:176916914-176916936 AAGTGAGGCTGGAGAGAGGCTGG - Intronic
917698205 1:177551516-177551538 GGGGGAGACTGGAGAGATGTTGG - Intergenic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
919417983 1:197335175-197335197 TAGTGTGACTGGAGTGAAGGAGG + Intronic
919521196 1:198590487-198590509 CAGGGAGAATGGAGAGAAAGTGG - Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919786520 1:201261740-201261762 CATTGAGAGAGGAGAGAGGTAGG + Intergenic
920393314 1:205625395-205625417 CAGTGATAGTGGCGACAAGTAGG - Intronic
920730743 1:208481728-208481750 CAGTGACAGTGGGGAGAAGAAGG - Intergenic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922769212 1:228173145-228173167 GAGTGAGACTGCAGAGATGAGGG + Intronic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923188670 1:231598665-231598687 CAGTGAAACTGCAGATAAGCGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924074938 1:240323940-240323962 CAGTGAGGCTTGAGAGAACTTGG - Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924750927 1:246888906-246888928 CAGAGAGAGAGGAGAGAATTGGG + Intronic
1064398967 10:15004674-15004696 TGGTGAAACTAGAGAGAAGTAGG - Intergenic
1064511636 10:16100388-16100410 CAGTGTGAATGTTGAGAAGTGGG + Intergenic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065448611 10:25830037-25830059 CAGTTAGAGTGGAAAGAAGTAGG - Intergenic
1066075534 10:31871925-31871947 AAAGGAGACTGGAGAGATGTGGG - Intronic
1066709489 10:38217798-38217820 CGGGGAGACTGGAAACAAGTTGG + Intergenic
1067358924 10:45558750-45558772 CAGTGAGACCGGAGAGCATGCGG + Intronic
1068214805 10:53969401-53969423 CAGTGAGAATGGAACCAAGTTGG + Intronic
1068249347 10:54416758-54416780 CTGTGAGACTGTAGAGAAATAGG - Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069585854 10:69601453-69601475 CACAGAGTCTGGAAAGAAGTTGG - Intergenic
1070023322 10:72607757-72607779 CAGTGAGGTTGGACAGAACTGGG + Intronic
1070266037 10:74904149-74904171 CAGTGAGTCTCCAGAGAAGCTGG - Intronic
1070282425 10:75059391-75059413 AAAGGAGACTGGAGAGAAGGAGG + Intergenic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1070874250 10:79787472-79787494 GAATTAGACTGGAGAGAACTTGG + Intergenic
1070875537 10:79803450-79803472 CAATGAAAGTGGAGTGAAGTTGG + Intergenic
1071460506 10:85889314-85889336 AGGGGAGATTGGAGAGAAGTTGG - Intronic
1071641181 10:87309626-87309648 GAATTAGACTGGAGAGAACTTGG + Intergenic
1071766540 10:88672341-88672363 CAGAGAGACTGGAAAGAGGAGGG + Intronic
1071818464 10:89255580-89255602 CAGTGAAAGTGGAGAAAAATAGG + Intronic
1072493871 10:95935337-95935359 CAGAGAGGCTGGTGAAAAGTGGG - Intronic
1072876346 10:99176666-99176688 CAGGGAGAATGGAGCCAAGTTGG + Intronic
1073117150 10:101097620-101097642 ACATGAGACTGGAGAGAAGCTGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074388669 10:113037962-113037984 AAGTGAGAATGGGAAGAAGTTGG + Intronic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076179231 10:128393227-128393249 CAGTGAGACGCGAGAGAGCTAGG + Intergenic
1076824175 10:132958972-132958994 CAGCGAGACTGGGGAGCAGCAGG + Intergenic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077591720 11:3497548-3497570 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1077604195 11:3596478-3596500 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1078150390 11:8754428-8754450 TAGTGAGACTGTAGAGAAATTGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078337047 11:10472961-10472983 CAGCCAGGCTGGAGAGCAGTGGG - Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078831824 11:14984794-14984816 TGGTGAAACTGGAGGGAAGTAGG - Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079135731 11:17775153-17775175 CAGTGAGACTGGAAAGGCCTTGG - Intronic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1080157356 11:29127238-29127260 AAGGGAAACTGGTGAGAAGTTGG + Intergenic
1081496863 11:43620375-43620397 AAGTGAGACTGATGAGAACTCGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083848888 11:65354109-65354131 CAGCGAGGCTGGAGAGCAGCTGG + Intergenic
1083855907 11:65393009-65393031 CAGTGAGAGAGGAGATAAGGTGG + Intronic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1084226645 11:67719290-67719312 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084260093 11:67971072-67971094 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084812679 11:71624182-71624204 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1084825267 11:71725228-71725250 CAGTGAGAATGGAACCAAGTTGG + Intergenic
1084845653 11:71897568-71897590 TGGTGAGACTAGAGAGAAGTAGG + Intronic
1084903561 11:72328536-72328558 GACTGAGACTGAAGAGATGTGGG - Intronic
1086999693 11:93402879-93402901 AAGGGAGAATGAAGAGAAGTTGG + Intronic
1087480509 11:98693967-98693989 CATTGAGACTTGAGAGGAGCCGG + Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088241169 11:107775150-107775172 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
1088269712 11:108021523-108021545 CACTCAGACTGGAGTGCAGTGGG + Intronic
1089566975 11:119376810-119376832 ATGTGAGACTGCAGAGAAGATGG - Intronic
1090342219 11:126034172-126034194 GACTGAGACTTGGGAGAAGTGGG - Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1093092877 12:14941035-14941057 CTGTGAGACTGCAGAGAAAAGGG + Intergenic
1093344617 12:18025307-18025329 CAGGGAGAATGGAGCAAAGTTGG + Intergenic
1093363242 12:18258424-18258446 GAGGGAGACTGGGGAGATGTTGG - Intronic
1094708361 12:32936713-32936735 AAATGAGACTGGAGAAAAGCGGG + Intergenic
1095033307 12:37322480-37322502 CAGGGAGACTGGAACCAAGTTGG - Intergenic
1095490056 12:42724413-42724435 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1096501947 12:52069660-52069682 CATAGAGACTGGAGGGAAGGAGG - Intronic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1097221247 12:57452457-57452479 CAGTGAGGGTGGGGAGAGGTGGG + Intronic
1097663989 12:62460075-62460097 TAGTGATAGTGGAGAAAAGTGGG + Intergenic
1097701152 12:62821314-62821336 CAGGGAGAATGGAAACAAGTTGG + Intronic
1097917343 12:65035052-65035074 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1097933503 12:65217856-65217878 CACTCAGGCTGGAGTGAAGTAGG + Intronic
1098013562 12:66080357-66080379 CAGTGAAACAAGGGAGAAGTGGG + Intergenic
1098082263 12:66800198-66800220 CAGGGAAACTGGAGAGAGGGAGG - Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100112306 12:91260398-91260420 GAGGGAGAATGAAGAGAAGTGGG + Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101012915 12:100469897-100469919 CTCTGAGACAGGAGAGAGGTTGG - Intergenic
1101440902 12:104703705-104703727 CAGTGAGCCTGGAATGGAGTGGG - Intronic
1101783497 12:107860907-107860929 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1101816589 12:108150627-108150649 CAGTGACACAGGAGAGAGGCAGG + Intronic
1101844713 12:108353572-108353594 GAGGGAGATTGGAGAGAAATGGG + Intergenic
1102097347 12:110250967-110250989 CTGTGAGAGTGGAGAAATGTTGG - Intergenic
1102708528 12:114904923-114904945 TAGTGAGATGGGAGAGAAGTGGG + Intergenic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1106273183 13:28174507-28174529 CAGTGAGATGGGTGAGATGTAGG + Intronic
1106653492 13:31717384-31717406 CATTGAAAATGAAGAGAAGTTGG - Intergenic
1106822934 13:33486570-33486592 GAGTGAAACCGCAGAGAAGTGGG + Intergenic
1106914171 13:34494496-34494518 CAGGGAGAATGGAAACAAGTTGG + Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107546322 13:41436805-41436827 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1108113633 13:47104044-47104066 CAGGGAGACTGGAACCAAGTTGG + Intergenic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110520633 13:76472172-76472194 CACCCAGACTGGAGAGCAGTTGG + Intergenic
1110525821 13:76535658-76535680 CAGTGAGGCTGTGGAGAAATAGG + Intergenic
1110565065 13:76949626-76949648 ATGTGAGACTGGGGAGCAGTGGG - Intronic
1110642500 13:77841738-77841760 TAGTGAGAATGGGGAGAAATTGG - Intergenic
1110770594 13:79339263-79339285 CAGGAAGAATGGAGAGATGTTGG + Intronic
1110783736 13:79497983-79498005 TAGTGGCACTGAAGAGAAGTGGG + Intronic
1111024171 13:82497602-82497624 CAATGAGAATGGGGAGAAATTGG - Intergenic
1111211043 13:85080780-85080802 CAGAGAGATGGGAGAGAAGGAGG + Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1111796504 13:92927333-92927355 CACCCAGACTGGAGTGAAGTGGG - Intergenic
1111928757 13:94491678-94491700 AAGAGAAACTGAAGAGAAGTGGG + Intergenic
1112101188 13:96191131-96191153 CAGTGATAATGTAGAGAGGTGGG - Intronic
1112214081 13:97412068-97412090 AGGTGAGACTGAAGGGAAGTTGG - Intergenic
1112389989 13:98974299-98974321 CAGTAAGCCTGGATAGAAATGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112574974 13:100627459-100627481 CCGTGAGACAGGAGAGAGGCAGG - Intronic
1112583537 13:100696873-100696895 CAGTGAGACAGCAGAGATGGTGG - Intergenic
1113181931 13:107638841-107638863 TAGTGAGGCTGGAGAACAGTGGG + Intronic
1114055449 14:18964215-18964237 AAGGGAGAATGAAGAGAAGTTGG + Intergenic
1114107096 14:19437548-19437570 AAGGGAGAATGAAGAGAAGTTGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1115329592 14:32181715-32181737 CATTGAAACTGATGAGAAGTTGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116123816 14:40755885-40755907 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1118019409 14:61695647-61695669 TCGTGAGACTAGAGAGAAGCGGG - Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1118780487 14:69004549-69004571 CAGGGAGACTGGACCAAAGTGGG - Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119772736 14:77231030-77231052 CAGTTACACTGGAGAACAGTTGG - Intronic
1119866225 14:77977415-77977437 CTGAGAGAGGGGAGAGAAGTGGG + Intergenic
1120021586 14:79537092-79537114 TAGTGAGGCTGTGGAGAAGTAGG - Intronic
1121780283 14:96617783-96617805 AAGTGAAACTGGAGAGCTGTGGG + Intergenic
1122404421 14:101491482-101491504 CATGAAGACTGGGGAGAAGTGGG + Intergenic
1123467683 15:20528688-20528710 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1123650430 15:22472354-22472376 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1123740838 15:23281196-23281218 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1123746160 15:23321362-23321384 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1124278427 15:28344679-28344701 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1124304273 15:28566929-28566951 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1124533148 15:30523397-30523419 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1124765508 15:32484247-32484269 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1125362314 15:38877047-38877069 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1125933346 15:43615603-43615625 CTGGGAGACTGGAGAGCAGTAGG + Exonic
1125946444 15:43715065-43715087 CTGGGAGACTGGAGAGCAGTAGG + Intergenic
1126086909 15:45019683-45019705 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126846032 15:52761236-52761258 AAGTAAGACTGGACAGAAGGAGG - Intronic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1127175150 15:56346237-56346259 CAGAGAGGCAGGAGAGAAGCAGG + Intronic
1127369792 15:58328880-58328902 CAGTGAGATTGCAGAGAAAAGGG + Intronic
1127800024 15:62470143-62470165 CACTGAGACTGCACATAAGTGGG + Intronic
1130020942 15:80231189-80231211 ATGTGAACCTGGAGAGAAGTAGG - Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130422745 15:83764491-83764513 CAGGGCGACTGGAGAGAGGGAGG + Intronic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131150060 15:90042224-90042246 CAAGGAGGCTGGAGAGAAGGGGG - Intronic
1131961179 15:97791836-97791858 CCGTGAGATTGGTGAGAATTGGG - Intergenic
1131977717 15:97961828-97961850 CATTTTGAGTGGAGAGAAGTGGG - Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1137991624 16:53162821-53162843 CACTCAGACTGGAGTGCAGTGGG + Intronic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138933064 16:61685124-61685146 AATTGAGAATAGAGAGAAGTTGG + Intronic
1139422782 16:66859263-66859285 CAGCCACACTGGAGTGAAGTGGG - Intronic
1139450492 16:67025082-67025104 AAATGAGACTTGAGAGGAGTGGG - Intergenic
1139842339 16:69891724-69891746 TAGTGAGTCAGGAGAGAACTGGG - Intronic
1139975586 16:70807609-70807631 GAGTGAGACTGGAGTTAAATGGG - Exonic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1142507939 17:377233-377255 CAGAGAGAGTGGGGAGAAGAGGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143042973 17:4053033-4053055 CAGTGAGAATGAACAGAAGTGGG - Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143501693 17:7343122-7343144 GAGTGAGATGGGAGAGAAGGGGG + Intronic
1143780815 17:9228375-9228397 CAGGGAGGCTGGAGAGAGGCTGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146518976 17:33511587-33511609 CAGTGAGACAGGGAGGAAGTGGG - Intronic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148680670 17:49471787-49471809 GAGTGAGACTGGCCAGAGGTGGG - Intronic
1148705206 17:49624142-49624164 GAGTGGGACTGGGGAGATGTAGG + Intronic
1148948314 17:51285563-51285585 CAGTGAAACTGCAGATAAGGGGG - Intronic
1149351580 17:55793388-55793410 GAGTGAGAGTGCAGAGAATTCGG - Intronic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1150227475 17:63531761-63531783 CTGTTAGACTGGAGAGTGGTCGG + Intronic
1150480434 17:65504718-65504740 CTGTGAGCCTGGAGAGAGGGAGG - Intergenic
1151380575 17:73723007-73723029 CAGTGAGACTGTACTGCAGTTGG + Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153521000 18:5953840-5953862 CAGAAAGACTAGTGAGAAGTGGG + Intergenic
1153781175 18:8496159-8496181 CAGAGAGACTGGAAAGCACTCGG - Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155044084 18:22088583-22088605 CAGTGAGACAACAGAGAGGTTGG + Intronic
1155236082 18:23820822-23820844 CAGTCAGCCTGTAGAGAAGCTGG + Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1156507577 18:37608059-37608081 GAGGGAGACGGGAGAGAAGCAGG + Intergenic
1156813595 18:41281698-41281720 CTGTGAGACTGGAGCAAATTTGG - Intergenic
1157139503 18:45091536-45091558 GAGTTAGACTGGCAAGAAGTTGG - Intergenic
1157177502 18:45464975-45464997 CAGGCAGGCAGGAGAGAAGTAGG + Intronic
1157193999 18:45605604-45605626 CCTTGAAACTGGAGAGAAGTGGG + Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157757735 18:50233589-50233611 CAGGGAGACAGGCGAGAAGAAGG - Intronic
1157925535 18:51761538-51761560 TGGTGAGACTGTAGAGAAATTGG - Intergenic
1158425530 18:57336900-57336922 CAGGGTGACTGGGGAGATGTTGG - Intergenic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1159553950 18:69925708-69925730 GAGCGAGACTGGAGTGAAGGAGG - Intronic
1161446815 19:4323303-4323325 CAGTGGGACCGGTCAGAAGTGGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162802857 19:13120499-13120521 TAGGGAGACTGGGGAGAATTAGG - Intronic
1163202689 19:15779974-15779996 CAGGGACAGTGGAGAGAAGCAGG + Intergenic
1164230573 19:23284073-23284095 CCGTGAGACTGGGGAGATGCAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166089511 19:40499066-40499088 CACTCAGACTGGAGTGCAGTGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166595235 19:44041979-44042001 TCTTGAGACTGGGGAGAAGTGGG + Intergenic
1166878263 19:45911481-45911503 CAGGGAGTCTGGACTGAAGTAGG - Intergenic
1167606313 19:50482609-50482631 CACAGAGGCTGGAGAGAAGGCGG - Exonic
1167634922 19:50648909-50648931 CAAGGAGACTGGTGAGAGGTGGG + Intronic
925560983 2:5195201-5195223 CAGTGAGATTGGATACAAGTTGG + Intergenic
926109653 2:10173756-10173778 CAGTGAAATTGGAGAGAACGAGG + Intronic
926218480 2:10919970-10919992 CAGGGAGACTGAAGCGAAGGAGG - Intergenic
927182955 2:20460154-20460176 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
927624526 2:24700596-24700618 CATTGAGATTGGAGGGAAATGGG + Intronic
927784658 2:25965299-25965321 GGGTGAGACTGGGGAGAAGGAGG - Intronic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
928955335 2:36860894-36860916 CAATAAGACTTTAGAGAAGTGGG + Intronic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929964402 2:46522874-46522896 CAGTGAGGCCGTAGAGAAATAGG - Intronic
930845284 2:55897028-55897050 CATTTAGACTTTAGAGAAGTAGG - Intronic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
936039303 2:109137656-109137678 CAGAGATACTGGAGAGAAAGAGG + Intronic
936073791 2:109388826-109388848 GAGAGAGACTAGAGAGAAGGGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
938224131 2:129601169-129601191 CAGGGAGACTGGAACCAAGTTGG - Intergenic
938473613 2:131588792-131588814 AAGGGAGAATGAAGAGAAGTTGG + Intergenic
939180547 2:138797485-138797507 CAGGGAGAATGGAAACAAGTTGG + Intergenic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
939661435 2:144895516-144895538 CACGGAGCCTGGGGAGAAGTGGG - Intergenic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
940267795 2:151858259-151858281 CAGGGATCCTGGAGAGAGGTGGG - Intronic
940625829 2:156173659-156173681 CTGAGAGGCAGGAGAGAAGTTGG - Intergenic
940749095 2:157603960-157603982 AAGTGAGAGTGGGGAGATGTGGG - Intronic
942008525 2:171734559-171734581 CAGTAACACTGGAGGGATGTTGG - Intronic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
946008079 2:216542408-216542430 CAGTGAGACTTGAGGCAGGTAGG + Intronic
946113324 2:217439077-217439099 CAGAGTTACTGGAGAGAAGTAGG - Intronic
946770709 2:223085769-223085791 CACTCAGACTGGAGTGCAGTGGG + Intronic
948278008 2:236724900-236724922 CAATGAGACTGGAGAAGAATGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168752113 20:290185-290207 CCGTGAGAGTGGAGAGCAGGTGG + Intronic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169110957 20:3033394-3033416 CAGTTACGCTGGAGAAAAGTGGG - Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1170115859 20:12858840-12858862 TGGTGAGACAGGAGAGAAGTGGG + Intergenic
1170881961 20:20304729-20304751 CAGTGAGGGTGTGGAGAAGTGGG + Intronic
1171105743 20:22430764-22430786 CAGAAAGACAAGAGAGAAGTAGG + Intergenic
1171303898 20:24088480-24088502 CAGTGAAACTGGAGTGAAGGAGG - Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1173048302 20:39533987-39534009 AAATGAGCCTGGAGAGAAATAGG - Intergenic
1173059300 20:39646353-39646375 GAGTGAAACTGAACAGAAGTAGG - Intergenic
1173089471 20:39956312-39956334 CCGTAAGACTGGAGAGTACTGGG + Intergenic
1173236224 20:41248021-41248043 CAGTGAAACTGGAGAGGCGCAGG - Intronic
1173285008 20:41662377-41662399 AAGTGAGAATGGAGAAAAATGGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174061588 20:47836750-47836772 CAGTGAGATAGGAGAGGAGCAGG + Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175532385 20:59682841-59682863 GAGGGAGACGGGAGAGAAGCAGG + Intronic
1175694728 20:61093222-61093244 AAATGAGACTGGAGAGAGGGTGG - Intergenic
1175696424 20:61106202-61106224 CAGAAAGGCTGGAGAGAGGTGGG + Intergenic
1176006315 20:62865276-62865298 AGGTGAGACTGGATAGAAGTCGG + Intergenic
1177694735 21:24556366-24556388 CAGGGAGAATGGAACGAAGTTGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178009994 21:28273733-28273755 CATTGAGAATGGTTAGAAGTGGG - Intergenic
1178039947 21:28629229-28629251 CAGTGAGACTTTAGAGAAAGAGG - Intergenic
1178443354 21:32616503-32616525 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1178478281 21:32956685-32956707 CAATGAGACTAGAGAGAGTTTGG + Intergenic
1179252752 21:39686759-39686781 CAGTGAGATTGGTGAGATGTAGG + Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1180473927 22:15686767-15686789 AAGGGAGAATGAAGAGAAGTTGG + Intergenic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1180749180 22:18112328-18112350 AAGTGAGACAGGTCAGAAGTTGG - Intronic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1182101614 22:27661723-27661745 CACTCAGACTGGAGTGCAGTGGG - Intergenic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183270709 22:36861001-36861023 CTGCCAGACTGGAGAGAAGCAGG + Exonic
1183709498 22:39494546-39494568 CAGTGAGACTGGAGGGGCTTGGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184379888 22:44138631-44138653 CACTGAGACTGGATAGGAGGTGG - Intronic
1184640702 22:45868487-45868509 ACGTGAGACTGGAGAGAAAGAGG - Intergenic
1184733677 22:46385463-46385485 CAGTGAGCCTGGAGTGAGGCGGG + Intronic
1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG + Intergenic
949466071 3:4345078-4345100 CAGGGAGAATGGAAACAAGTGGG + Intronic
949466451 3:4349342-4349364 TAGTGAGGCTGTGGAGAAGTAGG + Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950060329 3:10065886-10065908 CCTGGAGCCTGGAGAGAAGTTGG + Exonic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
950925070 3:16732212-16732234 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951537903 3:23756336-23756358 CAGGGAGACTGGAGGCAGGTGGG - Intergenic
952158353 3:30668356-30668378 CACAGAGACCGGAGACAAGTGGG + Intronic
953047388 3:39306073-39306095 CAGGGAGAATGGAACGAAGTTGG + Intergenic
953606423 3:44415852-44415874 CAGTGGGACAGCAGAGAACTTGG + Intergenic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954248780 3:49352545-49352567 CAGGCATCCTGGAGAGAAGTTGG + Intergenic
954672877 3:52299884-52299906 CAGGGAGGGAGGAGAGAAGTGGG + Intergenic
955519612 3:59762301-59762323 AAGTGAAACTGGAGATAAGAGGG + Intronic
956220242 3:66894573-66894595 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956993434 3:74795754-74795776 CAGTGAGAATGGAACCAAGTTGG + Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
960000428 3:112725653-112725675 CAGGGAGAATGGAAACAAGTTGG + Intergenic
960746918 3:120900807-120900829 CAGGGAGAATGGAAACAAGTTGG - Intergenic
960832225 3:121862269-121862291 CAGAGAGAATGGAAACAAGTTGG - Intronic
961122458 3:124384592-124384614 CAGTGTCCCTGGAAAGAAGTGGG - Intronic
961276154 3:125728657-125728679 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
961686521 3:128636418-128636440 CATTCAGACTGGAGTGCAGTGGG - Intronic
961796920 3:129415717-129415739 CATTGAGACTGGTAGGAAGTGGG - Intronic
961875335 3:130018383-130018405 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962424589 3:135258591-135258613 CACTGAGACTGAAAAGATGTGGG - Intronic
962553943 3:136527191-136527213 CAGGGAGAATGGAAACAAGTTGG - Intronic
962884231 3:139608881-139608903 TTGGGAGACAGGAGAGAAGTGGG - Intronic
963435089 3:145257220-145257242 CAGGGAGAATGGAAACAAGTTGG - Intergenic
963460928 3:145614158-145614180 TAGTGAGACTGTAGAGAAATAGG - Intergenic
963484553 3:145919431-145919453 CAGGGAGAATGGAAACAAGTTGG + Intergenic
963531135 3:146474734-146474756 CAGGGAGAATGAAAAGAAGTTGG - Intronic
963532163 3:146484333-146484355 CAGAGAGAATGGAAATAAGTTGG + Intronic
963857581 3:150271175-150271197 CCCAGAGACTGGAGAGATGTAGG - Intergenic
964004004 3:151808566-151808588 TAATGAGAGAGGAGAGAAGTGGG - Intergenic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
964411778 3:156405299-156405321 CAGGAAGACTGGAGAGCAGGAGG - Intronic
964736066 3:159919204-159919226 TGGTGAGAATGCAGAGAAGTGGG + Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966155246 3:176909456-176909478 GAGAGAGACTGGAGAGTAGGAGG - Intergenic
966447706 3:180021761-180021783 TAGTGAGACTGGTGTTAAGTTGG + Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966726082 3:183109888-183109910 CAGTGAGGCTGTAGAGAAAAGGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
968082019 3:195853092-195853114 CACAGAGACTGAAGAGAAGGAGG + Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
968953839 4:3708340-3708362 GAGTGAGAATGGAGAGAGGCGGG - Intergenic
969118900 4:4892465-4892487 TACTGAGACTGGAGTGCAGTGGG + Intergenic
969735349 4:8985569-8985591 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969747225 4:9082073-9082095 CAGTGAGAATGGAACCAAGTTGG + Intergenic
969786654 4:9463400-9463422 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
970017237 4:11525776-11525798 CAGTGAGACTTGATAACAGTGGG - Intergenic
970336842 4:15055795-15055817 CACTGAGGCTGGAGAGAACAAGG - Intronic
970452708 4:16187568-16187590 CAGTGACACTTGAAAGAAATTGG - Intronic
970485538 4:16521100-16521122 CAGGGAGATTAGAGAGAAGCAGG + Intronic
970843992 4:20513922-20513944 CACTGCTACTGGAGAGTAGTGGG + Intronic
971360954 4:25937935-25937957 CAGTGAGATTGGAAAGCAGTTGG + Intergenic
971969270 4:33600855-33600877 CGGTGTGACTGTAGAGAAGGAGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
973856842 4:55019949-55019971 CAGTGTCACTGTAGAGCAGTGGG - Intergenic
974723077 4:65767297-65767319 CAGTGACACTGCAAAGCAGTGGG - Intergenic
975513854 4:75222862-75222884 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
975710985 4:77158847-77158869 GAGTGATACTTTAGAGAAGTGGG + Intronic
975884259 4:78945461-78945483 CAGTGAGACTGTGGAGAAATGGG - Intergenic
976376327 4:84349792-84349814 AAGAGAGACTTGAGAGAACTTGG - Intergenic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
978048671 4:104167489-104167511 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
978084704 4:104636431-104636453 CAATGAGATTGGAGATAAGAAGG - Intergenic
978797239 4:112720401-112720423 AAGTAAGACTGGAGAAAAGATGG - Intergenic
978883880 4:113743331-113743353 AAGTGAGACTGCAGAGAATCTGG - Intronic
979041296 4:115800257-115800279 CAGGGAGACAGGAGAGAAGGGGG - Intergenic
980090269 4:128436101-128436123 CAGGGAGAATGGAAACAAGTTGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980181535 4:129407323-129407345 CAGTCAGAGAGGAGAGAATTTGG + Intergenic
981255450 4:142656208-142656230 GGGTGAGAATGGAGAAAAGTGGG - Intronic
981401743 4:144321784-144321806 CATTGAGAATGGACAGAAGGAGG + Intergenic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
981643744 4:146974663-146974685 CAGTTAGACTGGACAGGAGCTGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981790792 4:148534708-148534730 CAGGGAGAATGGAAACAAGTCGG - Intergenic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983976179 4:173936984-173937006 GAGGGAGAGTGGGGAGAAGTAGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984419029 4:179496281-179496303 CAGGCATAGTGGAGAGAAGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985088528 4:186340287-186340309 GAGTGAGACTGGAGAGGAAGAGG + Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
986019978 5:3792077-3792099 CAGAGAGACTTGAGAGGGGTGGG + Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987362646 5:17121125-17121147 CAAAGAGAATGGAGAGAAGGTGG + Intronic
987961811 5:24820190-24820212 TAGCAAGACTGCAGAGAAGTGGG - Intergenic
988621658 5:32829635-32829657 CATTTAGACTGGAGAGGAGAAGG + Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
990705878 5:58528878-58528900 CATTGAGGCTGGTGAGAAGCTGG + Intergenic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993089625 5:83409308-83409330 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
993090240 5:83416729-83416751 AAGTGAGACAGGAGCGAAGGAGG - Intergenic
993119298 5:83754997-83755019 CGGGGAGAATGGAGACAAGTTGG + Intergenic
993276366 5:85864842-85864864 TAGGGAGGGTGGAGAGAAGTGGG + Intergenic
993289921 5:86053881-86053903 CAGTGATACTGGAGAACAATAGG - Intergenic
993420234 5:87692346-87692368 TGGTGAGACTGCAGAGAAATAGG - Intergenic
994120487 5:96107822-96107844 CAGGGAGAATGGAAACAAGTTGG - Intergenic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994224691 5:97238865-97238887 CAGGGAGAATGGAAACAAGTTGG - Intergenic
995663700 5:114516558-114516580 AAAAGAGACTGGAGAGATGTAGG - Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998403043 5:141858049-141858071 CAGTGAGACAGGTGAGGAGCTGG - Intronic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
998927347 5:147141162-147141184 CAGGGAGAATGGAAACAAGTTGG - Intergenic
999894011 5:156009060-156009082 CAGAGTGACTGGAGCGAAGGAGG + Intronic
1000152090 5:158513148-158513170 GAGAGAGAGAGGAGAGAAGTTGG + Intergenic
1000625119 5:163529645-163529667 CACTGAGCCTGGACAGAGGTGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002470613 5:179433159-179433181 CAGTGAGCCAGGAGAGAGGCCGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002512118 5:179727540-179727562 CAGAGAGAGTGGAGAAAAGAAGG + Intronic
1003077548 6:2996563-2996585 GCGTGAGAATGTAGAGAAGTTGG + Intronic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1004271725 6:14201692-14201714 CAGTGAGAAAGGTGAGAACTAGG + Intergenic
1004976509 6:20973413-20973435 CAGTGAGCGGGGAGTGAAGTAGG + Intronic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005332616 6:24764418-24764440 CAGGGAGACTGTGGAGAAGGAGG - Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1006430616 6:33993446-33993468 GAGTGAGGCTGGAGAGGATTGGG + Intergenic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007373199 6:41440288-41440310 CAGTGAGGCAGGAGAGATCTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008635700 6:53408357-53408379 CAGAGAGAGGGGAGAGAAGGTGG + Intergenic
1008637635 6:53427018-53427040 CAGTGAGGCAGGGGAGAGGTGGG + Intergenic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009481791 6:64168304-64168326 GGGTGAGAATGTAGAGAAGTGGG + Intronic
1009962618 6:70542035-70542057 AAGTGAGAATGGGGAGAAGGGGG - Intronic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010588232 6:77680849-77680871 GAGTGAGACTGATGAGAAGTAGG + Intergenic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1010674698 6:78728484-78728506 AAGTGAGACTGTAGAACAGTAGG - Intergenic
1011295042 6:85817466-85817488 CAGGGAGAATGGAAACAAGTAGG + Intergenic
1012718842 6:102714324-102714346 CACTGAGACATGAGAGAAGGGGG + Intergenic
1013895176 6:115079389-115079411 CAGTGAGAAAGCAGACAAGTAGG + Intergenic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1014987551 6:128030187-128030209 AAGTGATTCTGAAGAGAAGTGGG + Intronic
1015022733 6:128495890-128495912 CATGGAGACTGGAGAGAATGCGG - Intronic
1015256375 6:131183650-131183672 GAGTGAGCCTGGAGAGCACTGGG + Intronic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1015911308 6:138169981-138170003 CTGCAAGACTGGAGACAAGTTGG + Intronic
1016237448 6:141886244-141886266 CATTGAGAGTGGACAGAAGGAGG + Intergenic
1016569804 6:145498663-145498685 CAGGGAGAATGGAGAAAAGCAGG - Intergenic
1017412849 6:154187247-154187269 GAGAGAGACTGGACAGAGGTGGG - Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019841574 7:3451295-3451317 CACTGAGTCTGGAGAGAGGAAGG + Intronic
1020026537 7:4903813-4903835 CAGGGAGTCAGGAGAGCAGTCGG - Intergenic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1020310437 7:6863496-6863518 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020487504 7:8737730-8737752 CAGAGAGAATGGAAACAAGTTGG - Intronic
1020643981 7:10791261-10791283 CAGTGAAACTGCAAATAAGTGGG + Intergenic
1020833901 7:13125427-13125449 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1022332537 7:29394132-29394154 TTATGAGACTGCAGAGAAGTGGG - Intronic
1022634807 7:32121274-32121296 CAGGGAGAATGGAAACAAGTTGG + Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023557341 7:41436931-41436953 CAGTGAAACTGGCCAGAAGGAGG - Intergenic
1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024369740 7:48567455-48567477 CATTGAGATTGGGGAGTAGTTGG + Intronic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025088725 7:56044788-56044810 CAGTGAGACTGGAAAAAAAAAGG + Intronic
1026102752 7:67396336-67396358 AAGTGAGACTGGAAAGAACAAGG - Intergenic
1026184529 7:68072122-68072144 CAGCCAGACTGGAGTGGAGTGGG + Intergenic
1027340231 7:77199653-77199675 CAGTGAGACTAGAAAGCAGAGGG - Exonic
1027385919 7:77659688-77659710 CACTCAGACTGGAGTGCAGTGGG + Intergenic
1027484700 7:78746819-78746841 TAGTGAAAGTGGAGAGAATTGGG - Intronic
1027589736 7:80102612-80102634 CGGTGAGAATGTAGAGAAATTGG - Intergenic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1028469259 7:91186484-91186506 CAATGATAATGGGGAGAAGTTGG - Intronic
1028893830 7:96018614-96018636 GAGTGATGCTGAAGAGAAGTTGG + Intronic
1029077140 7:97943825-97943847 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1029645157 7:101850353-101850375 AAATGAGAGTGGGGAGAAGTGGG - Intronic
1029819511 7:103132381-103132403 CAGTAAGACTTGAGAGTATTTGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1030817655 7:114056461-114056483 CAGGGAGAATGGAAACAAGTTGG + Intronic
1030995326 7:116352641-116352663 CAATGAGAGTTCAGAGAAGTGGG + Intronic
1031767000 7:125792469-125792491 CGGTGAGAATGGAGAAAAATTGG + Intergenic
1032094348 7:128930091-128930113 GAGGGAGAGTGGAGAGAAGACGG + Intergenic
1032312425 7:130801125-130801147 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033384652 7:140860679-140860701 CAGTGAGACTGCAAAAAAATTGG + Intronic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1035826077 8:2645413-2645435 CAATGAGACCAGTGAGAAGTAGG - Intergenic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1036118234 8:5985004-5985026 CAATGAGAATGTAGAGAAATTGG + Intergenic
1036240645 8:7078121-7078143 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036261410 8:7243457-7243479 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036305189 8:7596099-7596121 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036313450 8:7702001-7702023 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036356039 8:8044095-8044117 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1037285321 8:17293048-17293070 CAGAGAGACTGGAACCAAGTTGG - Intronic
1037373818 8:18207623-18207645 CAGTGAGGCTGCAGAGAGATAGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038111371 8:24503384-24503406 TAGAGAGAATGGAGAGAAATAGG + Intronic
1038214741 8:25551175-25551197 CAGTGAGGCTGGACAGGTGTGGG - Intergenic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1038893316 8:31752295-31752317 CAGAGTGACTGGAGCTAAGTGGG + Intronic
1039170520 8:34739583-34739605 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1039329974 8:36526218-36526240 CAGGGAAACTGGAGAAAACTGGG + Intergenic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1040989987 8:53339190-53339212 CAGGGAGAATGGAGCCAAGTTGG + Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041664495 8:60429578-60429600 CAGGGAGACCTGTGAGAAGTTGG - Intergenic
1041845255 8:62320931-62320953 CAGGGAGAATGGAAACAAGTTGG - Intronic
1041885430 8:62802162-62802184 CAGGGAGAATGGAAACAAGTTGG + Intronic
1042194747 8:66222508-66222530 CTGGGAGACTGGAGACAAGGAGG - Intergenic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043461738 8:80467412-80467434 GAGGGAGAATTGAGAGAAGTTGG - Intergenic
1044205248 8:89485939-89485961 ACGTGACACGGGAGAGAAGTGGG + Intergenic
1044693565 8:94901318-94901340 CAGGGAGACTGGATAGGAGATGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045125602 8:99086057-99086079 CAGGGAGAATGGAAACAAGTTGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046380693 8:113446161-113446183 CAGTGAAACAGAAGAGAAGGTGG + Intergenic
1046698113 8:117365602-117365624 CAGTCAGACTTGAGAGTAGTGGG + Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046972379 8:120237207-120237229 CAGGGAGAATGGAACGAAGTTGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047316579 8:123740416-123740438 CATTGAGACTGGAGACTATTGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048456902 8:134586734-134586756 CACTGAGACAGGAGTGAAGGGGG - Intronic
1049460251 8:142723994-142724016 CATTGAGAATGGAGAGATTTAGG - Intergenic
1049640273 8:143712165-143712187 CAGAGGGAGTGCAGAGAAGTGGG - Intronic
1050123930 9:2337009-2337031 AGGTGAGAGTGGTGAGAAGTAGG - Intergenic
1050569054 9:6918651-6918673 TAGTGAGGCTGTAGAGAAGGGGG - Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052363431 9:27585188-27585210 CAGTGAGACTGGAAAGGGATTGG - Intergenic
1053375736 9:37604798-37604820 CAGGGAGAATGAAGGGAAGTGGG + Intronic
1054952757 9:70871396-70871418 AAGTAAGACTGGAGAGAATCGGG - Intronic
1055946548 9:81696387-81696409 GAGAGAGACAGGAGAGAAGTGGG + Intergenic
1056426212 9:86479792-86479814 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1056947921 9:91016149-91016171 CAGGGAGACTGGGGAGATCTTGG - Intergenic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1058091685 9:100813014-100813036 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1059459160 9:114418788-114418810 AAGGGAGACTGGAGAGGGGTGGG - Intronic
1059784008 9:117560867-117560889 TAGTGAGACTGCAGAGAAGAGGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060325273 9:122608595-122608617 CAGAGAGACTACAGAGAGGTGGG - Intergenic
1060868805 9:127022571-127022593 CAGTGAGACAGGACAGGGGTGGG - Intronic
1061824391 9:133248758-133248780 CACCGGGACTGGAGAGGAGTGGG + Intergenic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1185669524 X:1795007-1795029 AAGTGAGGATGGAGAGACGTTGG - Intergenic
1186350942 X:8738969-8738991 CAGTGTGACTGTAGAGATGCAGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1187289395 X:17938490-17938512 CAGTGAGAATTAAAAGAAGTAGG - Intergenic
1187423909 X:19160384-19160406 CAGTGCAATTGGAGAGAACTAGG - Intergenic
1187614774 X:20981245-20981267 CATTGAGACAGGACAGAAGGTGG + Intergenic
1187958117 X:24540731-24540753 CTGAGAGACTGGTGAGAGGTGGG + Intergenic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188564856 X:31514916-31514938 CAATGAGAGTTGAGAGAAATAGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1189881862 X:45502564-45502586 CAGTGAGACTGTAAACAGGTTGG - Intergenic
1190794357 X:53726982-53727004 AAGTGAAACTGCAGATAAGTGGG - Intergenic
1191647116 X:63493635-63493657 CAGGGAGAATGGAAAAAAGTTGG + Intergenic
1191852343 X:65594702-65594724 CAGTGAATCAGGAGAGAAGTAGG + Intronic
1192020720 X:67387791-67387813 CGGTGAGAATGGAAACAAGTTGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192910667 X:75601096-75601118 CGGTGAGAATGGAAACAAGTTGG - Intergenic
1193264245 X:79449631-79449653 CAGTGTCACAGGTGAGAAGTAGG - Intergenic
1194573904 X:95587537-95587559 AAGTGAGCCTGGTGAAAAGTCGG + Intergenic
1195147615 X:102032969-102032991 CAGGGAGAATGGAAAAAAGTTGG + Intergenic
1195177510 X:102325289-102325311 CGGTGAGAATGCAGAGAAATTGG + Intronic
1195181354 X:102361804-102361826 CGGTGAGAATGCAGAGAAATTGG - Intronic
1195405233 X:104505457-104505479 CACTGAGGCTGGAGTGAAATGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195635771 X:107114193-107114215 CAGTGAAATTGGAGAGAGGTAGG - Intronic
1195715418 X:107813480-107813502 CAGAGAGACTGGCGAAGAGTTGG + Intergenic
1195846101 X:109230327-109230349 CAGGGAGAATGGAAACAAGTTGG + Intergenic
1195854819 X:109319509-109319531 CAGGGAGAATGGAAACAAGTTGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196516436 X:116617942-116617964 AAGCCAGACTGGAGAGAAGGAGG + Intergenic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1197274873 X:124466716-124466738 CAGGGAGAGTGGACAGAAGAAGG - Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197820428 X:130536061-130536083 CAGGGAGACAGGAAAGAAGAAGG - Intergenic
1197872934 X:131076688-131076710 CCCTGAGACTGAAGAGAACTGGG + Intronic
1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG + Intronic
1198250241 X:134872707-134872729 CAGTGAGACATGCAAGAAGTTGG - Intergenic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1199372720 X:147070046-147070068 CAGAGAGACTGGAGAGGAAGGGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1200298869 X:154952161-154952183 CCATGAGGCTGGAGAGAAGAGGG + Intronic
1200648439 Y:5813269-5813291 CAGGGAGACAGGAAAGAAGAAGG - Intergenic
1200744094 Y:6888134-6888156 CGGTGAGACTGTGGAGAAATAGG - Intergenic
1201308391 Y:12571095-12571117 CAGGGAGAATGGAAACAAGTTGG + Intergenic
1201334351 Y:12864151-12864173 GAGCCAGACTGGAGAGAGGTTGG + Intergenic
1201414894 Y:13738610-13738632 CAGTGTGACTGTAGAGATGCAGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201561347 Y:15320903-15320925 CAGGGAGAATGGAGCCAAGTTGG - Intergenic