ID: 1048196883

View in Genome Browser
Species Human (GRCh38)
Location 8:132338717-132338739
Sequence CAGCATCCCCTCAGCAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048196883_1048196884 4 Left 1048196883 8:132338717-132338739 CCTTTCTTGCTGAGGGGATGCTG 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1048196884 8:132338744-132338766 AGAAAAAATTAAGCTGCTTCTGG No data
1048196883_1048196885 15 Left 1048196883 8:132338717-132338739 CCTTTCTTGCTGAGGGGATGCTG 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1048196885 8:132338755-132338777 AGCTGCTTCTGGCAGAAAATAGG No data
1048196883_1048196887 26 Left 1048196883 8:132338717-132338739 CCTTTCTTGCTGAGGGGATGCTG 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1048196887 8:132338766-132338788 GCAGAAAATAGGCAGGAAACTGG No data
1048196883_1048196886 19 Left 1048196883 8:132338717-132338739 CCTTTCTTGCTGAGGGGATGCTG 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048196883 Original CRISPR CAGCATCCCCTCAGCAAGAA AGG (reversed) Intronic
900426254 1:2580764-2580786 CAGCATCCTCTCAGCCACAGTGG + Intergenic
900557138 1:3286338-3286360 CAGCGTCCCCACAGCCCGAAGGG + Intronic
900592984 1:3468068-3468090 CAGCCTCCCCACAGATAGAAAGG + Intronic
903029357 1:20451883-20451905 CAGCAACCCCTCAGCAGGCCTGG + Intergenic
903463136 1:23533101-23533123 CTGCTTCCTCTCAGCCAGAATGG + Intergenic
903695815 1:25206049-25206071 CAGCATCCCCACAGCATGTGTGG - Intergenic
903916971 1:26771794-26771816 CAGCCTCCTCTCAGAAAGGAGGG - Intronic
904042792 1:27593949-27593971 GAGCCTTCCCTCAGCAAGAGAGG + Intronic
904046508 1:27612429-27612451 CTGCATCCACCCAGCAGGAAAGG + Exonic
905452043 1:38063145-38063167 CAGCAGCCCCTCAGCATCATGGG - Intergenic
908177426 1:61569527-61569549 CAGCATCCCCGCAGGATGGAGGG - Intergenic
909040251 1:70640883-70640905 CAGGATCCCATAAGCATGAAGGG - Intergenic
920402201 1:205682985-205683007 CAGCAATCCCTCAGCAAGCCTGG + Intergenic
922034236 1:221832942-221832964 CATCATCCCCTTAGGAAAAATGG + Intergenic
1063068576 10:2635914-2635936 CACCATTCTCTCAGCAAGGATGG + Intergenic
1063081898 10:2775314-2775336 AAGCTTCCCCTCAGCAACATGGG - Intergenic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1064056637 10:12103375-12103397 CAGCATTCCCTTATCAATAATGG + Intronic
1065688854 10:28312951-28312973 CAGCACCCCCACAGCAGGAGGGG + Intronic
1067221303 10:44346125-44346147 CAGTTTCTCCTCAGCTAGAAAGG + Intergenic
1073336150 10:102711218-102711240 GAGCATCTCCTCAGGAAGAGTGG + Intronic
1075812486 10:125235077-125235099 GAACATCTTCTCAGCAAGAAGGG + Intergenic
1075838578 10:125477513-125477535 CTGCATCCCTCTAGCAAGAAAGG + Intergenic
1080631646 11:34082596-34082618 CAGCATCCCCCCAACCAGAGTGG + Intronic
1081909880 11:46694090-46694112 CAGCCTCCTCTCAGCAATCAGGG + Intronic
1084856063 11:71987465-71987487 CAGCATCCACTCTGCATGAATGG + Intronic
1084950580 11:72663070-72663092 CAGCATCGCCTCCTCAGGAAGGG + Intronic
1085859015 11:80210591-80210613 CAGCATTCTCACAGTAAGAATGG + Intergenic
1089844793 11:121450335-121450357 CAGCATCACCTTACCAGGAATGG - Intergenic
1090611469 11:128474796-128474818 CAACAGCCTCTGAGCAAGAAAGG + Intronic
1090788716 11:130070879-130070901 GAGCATCCCCGCTGCGAGAAAGG + Intronic
1091181117 11:133605593-133605615 AATCATCCACTCAGCATGAAGGG - Intergenic
1091246523 11:134100341-134100363 CACCTCCTCCTCAGCAAGAAAGG - Intronic
1091841073 12:3621251-3621273 CATCATCCCCTCTGCAAGCGAGG - Intronic
1093650841 12:21644044-21644066 CAGGAGTCCGTCAGCAAGAAGGG - Exonic
1096255336 12:50058748-50058770 CAGGATCCCCTCAACAAGGATGG + Exonic
1096605918 12:52766422-52766444 CCGCATCCCCTTAGCCTGAATGG - Intergenic
1100741627 12:97599890-97599912 GAGCATGCCTTCAGAAAGAAGGG - Intergenic
1100741766 12:97601688-97601710 CTGCATGCCATCAGGAAGAAGGG + Intergenic
1100826516 12:98479663-98479685 CAGCATGCCAGCTGCAAGAAGGG - Intergenic
1103248923 12:119483160-119483182 CTGCTTCCCCCCAACAAGAAGGG - Intronic
1106410350 13:29506919-29506941 TTGCATCCCCCTAGCAAGAAGGG + Intergenic
1106562369 13:30857953-30857975 CAGCCTCGGCTCAGCAAGGAAGG - Intergenic
1106871537 13:34026933-34026955 CAGTCTCTCCTCAGCCAGAAAGG + Intergenic
1108186584 13:47894007-47894029 CAGCTTCTCCTCTGTAAGAATGG - Intergenic
1110615520 13:77537593-77537615 CAGTAGCCCCTCAGCAGGGAGGG + Intronic
1113549975 13:111185181-111185203 GAGCTTCCCATCAGGAAGAAGGG + Intronic
1115036097 14:28858507-28858529 TAGCATCCCCATAGCTAGAAGGG - Intergenic
1117288059 14:54306758-54306780 CACCTTCCCCACAGGAAGAAAGG + Intergenic
1119406922 14:74404832-74404854 CAGGATCCCTTCAGGAAGGATGG + Intergenic
1120087867 14:80295934-80295956 CAGCATTCTCTCAGACAGAAAGG + Intronic
1122228268 14:100292187-100292209 CAGCATCCCAGCAGGAAGCAGGG + Exonic
1125539140 15:40459654-40459676 CAGCTTGCCCTCAGGAAGCATGG - Exonic
1128984570 15:72209907-72209929 CAGCATCACCTCAGAAGGAATGG + Intronic
1129797773 15:78391192-78391214 CAGAAACCCCTGAGCAGGAAAGG + Intergenic
1130044803 15:80435423-80435445 CAGCCTCCGCTCAGCAGCAACGG - Intronic
1134062184 16:11205956-11205978 CAGCATCCCCTGGGAAGGAAGGG - Intergenic
1134293235 16:12921199-12921221 CAGCATAACCTGAGCAAGTAAGG + Intronic
1139972734 16:70786258-70786280 CAGCACCCCCACAGCCGGAAAGG - Exonic
1140029318 16:71322326-71322348 CAGCATCCCAGTAGCAATAAGGG + Intergenic
1140305584 16:73799623-73799645 CTGCTTCCTCTCAGGAAGAAAGG + Intergenic
1141978595 16:87535072-87535094 CAGAATTCCCTGAGCAATAAGGG - Intergenic
1142966921 17:3587385-3587407 GAGCATCACCTTAGAAAGAAGGG + Intronic
1145795471 17:27653122-27653144 CCTCATCCCCCCAGCAGGAAGGG - Intergenic
1145809908 17:27758453-27758475 CCTCATCCCCCCAGCAGGAAGGG - Intronic
1152895982 17:82911543-82911565 CAGCATCACCCCAGCTAGGATGG + Intronic
1152929871 17:83104033-83104055 CAGCTCCCTCTCATCAAGAATGG - Intergenic
1154949228 18:21191929-21191951 GAGTTTCCCCTCAGGAAGAAAGG + Intergenic
1158235985 18:55314631-55314653 CAGAATCCCATCTCCAAGAAGGG - Intronic
1160720039 19:593047-593069 CAGCACTCTCTCAGCAGGAAGGG - Intronic
1163713310 19:18859877-18859899 CAACAGGCCCTCAGCAGGAATGG + Intronic
1163819757 19:19489487-19489509 CAGCATCCCAGCAGCCAGCAGGG - Intronic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
1165862171 19:38915085-38915107 CAGCATCCTCTCAGCAACCCTGG + Intergenic
1166950753 19:46426583-46426605 CCGCCTCCCCCCAGCAAGAGAGG + Intergenic
1167242873 19:48355566-48355588 CAGCAAGCGCTCAGCAACAAGGG + Intronic
1168140806 19:54385521-54385543 CAGCATCATCTTAGCAAGAAGGG + Intergenic
925868698 2:8250969-8250991 CAGCCTCCCCTCAGCCAGGGTGG + Intergenic
926863842 2:17337918-17337940 CAGCCTCCAATCAGCCAGAATGG - Intergenic
927695940 2:25239939-25239961 CAGTTTTCCCTGAGCAAGAAGGG - Intronic
930935109 2:56939542-56939564 CAGCCTCTCCTCAGCAAAACAGG + Intergenic
930981625 2:57532635-57532657 CAGCATATCCTCAGGCAGAAAGG - Intergenic
931264323 2:60646915-60646937 CAGCCTCCCCACAGAAAGGAAGG - Intergenic
932311429 2:70745337-70745359 CAACAACCCTACAGCAAGAATGG - Intronic
933587614 2:84196275-84196297 CACCATGCCCACAGAAAGAATGG - Intergenic
935764982 2:106358072-106358094 CTGCAGCCCCTCTGCAGGAAGGG - Intergenic
937438966 2:121901130-121901152 CAGCATGCCCTGAGCAACATGGG + Intergenic
938256522 2:129863676-129863698 CAGTGTCCCATCAGCAAGCAGGG - Intergenic
940576881 2:155519623-155519645 CAGCAGCCTGTCAGCAAAAAGGG - Intergenic
947181532 2:227415657-227415679 CTGCCTCCCCTCAGCCAGGAGGG + Intergenic
948401565 2:237689394-237689416 TAGCATCCTCTCATCTAGAAGGG + Intronic
1168823036 20:789490-789512 AAGCAACCCCTCAGAAAGTAGGG + Intergenic
1171002193 20:21425922-21425944 CAGCATCCCCTCTGCTAGAGGGG + Intergenic
1171289124 20:23970262-23970284 GAGCATCTGCTCAGAAAGAAGGG + Intergenic
1172740416 20:37162100-37162122 CAGCAGCCCACCAGCAAGATCGG - Intronic
1172882384 20:38210566-38210588 CTGCATCCCCTGGGGAAGAAGGG - Exonic
1176148378 20:63575525-63575547 AAGCATCACATCACCAAGAAAGG + Intergenic
1176664844 21:9676005-9676027 AAGCATCCCCTCAGGCAGCAGGG - Intergenic
1179039132 21:37786203-37786225 CAGCATCCTATCACCAAGACAGG - Intronic
1179792129 21:43761833-43761855 CTGCCTCCCATCACCAAGAAGGG - Exonic
1179823939 21:43953253-43953275 CTGCATCCCCGCAGCTAGGAAGG + Intronic
1181237645 22:21457382-21457404 CAGCATCTCCTGAGGAAGTAAGG + Intergenic
1182189975 22:28449232-28449254 CAGCATTCTCTCAACAAGTAGGG + Intronic
1183544226 22:38447171-38447193 CAGCCTGCTCTCAGCAAGACAGG - Intronic
1184267968 22:43360093-43360115 AAGCATCCACTCAGCAGGACAGG + Intergenic
1184813461 22:46853037-46853059 AAGTGTCCCCTCAGCAGGAAGGG - Intronic
1184847170 22:47095815-47095837 CAGCATCCCCTCACTGGGAAAGG - Intronic
953202406 3:40789285-40789307 CAGCATACTCTCAGCAAGCTAGG + Intergenic
954458856 3:50614684-50614706 CAGCATCCCCTCCACAATGATGG - Intronic
961190615 3:124958122-124958144 CAGTATCCCAGCAACAAGAAAGG - Intergenic
961202030 3:125053002-125053024 CAGCATCCCCATGGCACGAAAGG + Intronic
961203594 3:125063282-125063304 CATCCTCCCCACAGCAAGCAGGG + Intergenic
961391749 3:126556259-126556281 CAGCAGCCCCTCACCAATGAGGG + Intronic
961872556 3:129999460-129999482 AAGTTTCTCCTCAGCAAGAAGGG + Intergenic
963250154 3:143095630-143095652 CAGGTGCCCCTCAGCATGAACGG + Intergenic
965101539 3:164305719-164305741 CAGCCTCCCCTCAGAAAGCAAGG - Intergenic
966504479 3:180684137-180684159 CATCCTCCCCTCAGCAATTAAGG + Intronic
970660460 4:18279612-18279634 CAGCTTTCTCTCTGCAAGAAGGG + Intergenic
971669728 4:29542053-29542075 CACCTTCCCCTCACCCAGAAGGG - Intergenic
977424500 4:96850407-96850429 CAGCAAAGCCTCAGCAAGATTGG + Intergenic
980835335 4:138185142-138185164 CAGCAGCTCCTCAGCATTAATGG + Exonic
981033887 4:140151724-140151746 CGGCCTCCCCTCACCCAGAAAGG + Intronic
981571837 4:146160034-146160056 CAACATCCCCACAGCAATGAAGG + Intergenic
981775738 4:148365215-148365237 CAGCATCCCCAAGGGAAGAAAGG - Intronic
982044858 4:151433915-151433937 CAGCATCCCTATAGCAAAAAAGG - Intronic
983277422 4:165635552-165635574 CAGCTTCCACACAGCCAGAAAGG - Intergenic
984414839 4:179445235-179445257 CAGAATTTCATCAGCAAGAATGG + Intergenic
985410320 4:189676646-189676668 AAGCATCCCCTCAGGCAGCAGGG - Intergenic
986590354 5:9362326-9362348 TAGCGTCCCCAAAGCAAGAAAGG - Intronic
986737991 5:10681900-10681922 CAGCATCCCTGCAGGAAGCATGG + Intronic
988941961 5:36155972-36155994 CTCCTTCCACTCAGCAAGAAAGG + Intronic
993830558 5:92752669-92752691 CAGTAGCCACTCAGTAAGAAAGG + Intergenic
996925984 5:128827304-128827326 CAACATGCTCTCAGCAAGCAAGG - Intronic
998215721 5:140237496-140237518 CAGCATCCTCTTACCAAAAAAGG + Intronic
999236836 5:150103695-150103717 CAGCAACCCTTCAGGCAGAAAGG + Intronic
1000102864 5:158033622-158033644 CAGCATCCCCAGAGCCAGAGTGG + Intergenic
1003280185 6:4684320-4684342 CAGCATGCCCTCCGGAGGAATGG + Intergenic
1007109566 6:39305059-39305081 CAGCATGGCCTCAGCCTGAATGG - Intronic
1009848333 6:69163004-69163026 CAGAATCCCCACAGCTGGAAAGG - Intronic
1012984887 6:105865452-105865474 TGGCATCCCCTCAGCATGAGAGG + Intergenic
1016027316 6:139300464-139300486 AGGCATCCCCTCACCATGAAAGG - Intergenic
1016859402 6:148701694-148701716 AAGCATCCCCTGAGCTGGAAAGG + Intergenic
1016975875 6:149807022-149807044 CCACATCGCCTCAGCAAAAATGG - Intronic
1020879473 7:13741648-13741670 CAGGATGCCCTTAGCATGAAGGG + Intergenic
1023309322 7:38867673-38867695 CATCATCCTCTAAGAAAGAAGGG + Intronic
1023876051 7:44286932-44286954 CAGCAGACACTCAGCAGGAAGGG + Intronic
1026118880 7:67519222-67519244 TAGGATCCCCTCAGCCAGGAGGG - Intergenic
1032764922 7:134982254-134982276 CAACATGCCCTCAGCCGGAAAGG + Intergenic
1033493039 7:141863091-141863113 CAGCAACCCCCCAGCATAAAAGG - Intergenic
1034527680 7:151675987-151676009 CAGCATCCCCTCATTGGGAACGG + Intronic
1035983599 8:4401478-4401500 CACCATCCCCTCACCCAGAGAGG + Intronic
1037915342 8:22769530-22769552 GAGCATCCACGCAGCAGGAAAGG - Intronic
1038666722 8:29543740-29543762 CAGCTTCTCATCAGCCAGAAAGG - Intergenic
1038890649 8:31718683-31718705 GTGCATCCCCTCAACAAGAAAGG - Intronic
1039476112 8:37840209-37840231 GGGCACCCCCTCCGCAAGAAGGG + Exonic
1039763950 8:40608382-40608404 CAGCTTCCACACAGCCAGAAAGG + Intronic
1042791362 8:72610233-72610255 TATAATCCCCTCAGCATGAAGGG + Intronic
1042963934 8:74330817-74330839 GAGCTTCCCTTCAGGAAGAAAGG + Intronic
1043849841 8:85204314-85204336 CAGTCTCTCCTCAGCCAGAAAGG - Intronic
1048196883 8:132338717-132338739 CAGCATCCCCTCAGCAAGAAAGG - Intronic
1048264168 8:132971005-132971027 CAGGATCCCCTCACCAAGAAGGG + Intronic
1048292689 8:133192571-133192593 CAGCTTCCCCTAAGTAGGAATGG - Intronic
1052964895 9:34332723-34332745 CAGCTTCGTCTCTGCAAGAATGG + Intronic
1053173160 9:35905163-35905185 CAGCATGCCCACAGCAGAAAGGG + Intergenic
1055598961 9:77895406-77895428 CAGATTCCCCTCACCAAGACTGG - Intronic
1056607100 9:88095080-88095102 CTGCCTCTCCTCAGCAGGAATGG - Intergenic
1058189059 9:101891104-101891126 CAGCATTCCATCATCAACAAAGG - Intergenic
1059378133 9:113901619-113901641 GAGCTTCCACTCAGCTAGAATGG - Intronic
1060007345 9:120012319-120012341 AACCCTCCACTCAGCAAGAAAGG + Intergenic
1060134991 9:121144930-121144952 CAGAATCTCCTCAGGCAGAAGGG + Exonic
1060401758 9:123353723-123353745 CAGCGTCCCCTCAGCCAGGGAGG + Intergenic
1062043245 9:134413764-134413786 CAGCAGCCCCTCAGAAGCAAAGG - Intronic
1203661254 Un_KI270753v1:45742-45764 AAGCATCCCCTCAGGCAGCAGGG + Intergenic
1203672438 Un_KI270755v1:28834-28856 AAGCATCCCCTCAGGCAGCAGGG + Intergenic
1185516512 X:703010-703032 TAGTATCCCTTCAGCAAGCAGGG - Intergenic
1186173060 X:6897903-6897925 CAGCATCTCCTCTGCAAAAAGGG + Intergenic
1187927182 X:24260958-24260980 CAGGATGCCCGCAGCAAGACAGG - Intergenic
1188606732 X:32040651-32040673 CAGTATTTCATCAGCAAGAAGGG + Intronic
1188749883 X:33892358-33892380 CAGCATCCACTTATTAAGAATGG - Intergenic
1190708567 X:53049494-53049516 CAGCATCCCTCCACCAAGGATGG + Intronic
1196530530 X:116781822-116781844 CAACAACCCCTCTGAAAGAAGGG + Intergenic
1199268549 X:145856221-145856243 CCTCAGCCCCTCAGCAAGGAAGG - Intergenic
1202380736 Y:24275059-24275081 CACCATGACTTCAGCAAGAAGGG - Intergenic
1202490048 Y:25395066-25395088 CACCATGACTTCAGCAAGAAGGG + Intergenic