ID: 1048196886

View in Genome Browser
Species Human (GRCh38)
Location 8:132338759-132338781
Sequence GCTTCTGGCAGAAAATAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048196883_1048196886 19 Left 1048196883 8:132338717-132338739 CCTTTCTTGCTGAGGGGATGCTG 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048196886 Original CRISPR GCTTCTGGCAGAAAATAGGC AGG Intronic
No off target data available for this crispr