ID: 1048199214

View in Genome Browser
Species Human (GRCh38)
Location 8:132357812-132357834
Sequence ATTGGAGGAGGAGCAGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048199214 Original CRISPR ATTGGAGGAGGAGCAGCCAT AGG (reversed) Intronic