ID: 1048199743

View in Genome Browser
Species Human (GRCh38)
Location 8:132362445-132362467
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048199739_1048199743 23 Left 1048199739 8:132362399-132362421 CCACATTGCCAAGTCATTTGCAA 0: 1
1: 0
2: 4
3: 91
4: 3157
Right 1048199743 8:132362445-132362467 CAGTTCCAGCAGAAACTGAGAGG No data
1048199740_1048199743 15 Left 1048199740 8:132362407-132362429 CCAAGTCATTTGCAAACATCTAC 0: 1
1: 0
2: 0
3: 15
4: 238
Right 1048199743 8:132362445-132362467 CAGTTCCAGCAGAAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr