ID: 1048199743 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:132362445-132362467 |
| Sequence | CAGTTCCAGCAGAAACTGAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048199739_1048199743 | 23 | Left | 1048199739 | 8:132362399-132362421 | CCACATTGCCAAGTCATTTGCAA | 0: 1 1: 0 2: 4 3: 91 4: 3157 |
||
| Right | 1048199743 | 8:132362445-132362467 | CAGTTCCAGCAGAAACTGAGAGG | No data | ||||
| 1048199740_1048199743 | 15 | Left | 1048199740 | 8:132362407-132362429 | CCAAGTCATTTGCAAACATCTAC | 0: 1 1: 0 2: 0 3: 15 4: 238 |
||
| Right | 1048199743 | 8:132362445-132362467 | CAGTTCCAGCAGAAACTGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048199743 | Original CRISPR | CAGTTCCAGCAGAAACTGAG AGG | Intronic | ||
| No off target data available for this crispr | |||||