ID: 1048205959

View in Genome Browser
Species Human (GRCh38)
Location 8:132415419-132415441
Sequence CAGAGAGCTCCCAGACTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048205959_1048205969 28 Left 1048205959 8:132415419-132415441 CCCATGAGTCTGGGAGCTCTCTG 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1048205969 8:132415470-132415492 GATTTCCAGGGCCCAGCCCCCGG No data
1048205959_1048205964 15 Left 1048205959 8:132415419-132415441 CCCATGAGTCTGGGAGCTCTCTG 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1048205964 8:132415457-132415479 TCACCCACCTCTGGATTTCCAGG No data
1048205959_1048205965 16 Left 1048205959 8:132415419-132415441 CCCATGAGTCTGGGAGCTCTCTG 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1048205965 8:132415458-132415480 CACCCACCTCTGGATTTCCAGGG No data
1048205959_1048205962 6 Left 1048205959 8:132415419-132415441 CCCATGAGTCTGGGAGCTCTCTG 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1048205962 8:132415448-132415470 GGAGCCAAGTCACCCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048205959 Original CRISPR CAGAGAGCTCCCAGACTCAT GGG (reversed) Intronic
902524309 1:17045401-17045423 CAGACTGCTCTCAAACTCATGGG - Intronic
902607141 1:17575001-17575023 CAGGGATGTCCCAGCCTCATGGG + Intronic
902607181 1:17575156-17575178 CAGAGAGGTCACAGGCTCTTGGG + Intronic
902669014 1:17959241-17959263 CAGGGAGCTCCCAGTCTCAAAGG - Intergenic
902698867 1:18158104-18158126 CAGGGAGCTCCCAGTCTGATGGG - Intronic
902777892 1:18686213-18686235 GAGAGACCTCCCAATCTCATGGG - Intronic
903448922 1:23439513-23439535 CTGAGAGCTCCCAGTCTGATGGG + Intronic
904943716 1:34183503-34183525 CAAAGAGCTCCCAGTCTAGTGGG + Intronic
904961283 1:34335075-34335097 CAGAGGACTCCCAGACCCTTAGG - Intergenic
905296554 1:36958026-36958048 CAAAGAGCACACAGGCTCATGGG - Intronic
905296603 1:36958328-36958350 CAAAGAGCACACAGGCTCATGGG - Intronic
905296922 1:36960237-36960259 CACAGGGCACACAGACTCATGGG - Intronic
905434841 1:37949138-37949160 CAGGGACCTCCCAGTGTCATGGG - Intergenic
905609362 1:39336369-39336391 CAGAGAGGTTCCAGAGTCTTGGG + Intronic
905959675 1:42033157-42033179 CAAAGAGTTCCCAGAATCATGGG - Intronic
906641207 1:47441604-47441626 CAGAGAGCTGGGAGACTCAATGG - Intergenic
906965787 1:50455112-50455134 CAGAGAGCTTCCAGAGCCAAGGG - Intronic
907985917 1:59530440-59530462 CAAAGAGCTCCCATTCTGATTGG + Intronic
912302269 1:108530381-108530403 AACAGAGCTCTCAGGCTCATTGG - Intergenic
912470461 1:109903171-109903193 CAGGAAGCTCACAGTCTCATGGG - Intergenic
912631250 1:111248464-111248486 CACAGAGCTCACAGTCTGATGGG + Intergenic
912810848 1:112793352-112793374 TAGAGATCTCCCAGTCTAATGGG + Intergenic
913222376 1:116669323-116669345 CTGAGAGCTGCCAGAGTCACGGG - Intergenic
915009997 1:152676447-152676469 CAGAGACCACAAAGACTCATGGG + Exonic
915042804 1:152982969-152982991 CAGAGAGCTCCTAGAATGACAGG + Intergenic
916143110 1:161716757-161716779 CAGAGAGCTACCAAAATCCTGGG - Intergenic
917431587 1:174975006-174975028 CAGAGAGAACCCAGACACAGAGG - Intronic
919834068 1:201561801-201561823 CAGGGAGTTCCCAGGCTGATGGG - Intergenic
920083980 1:203401052-203401074 CAGAGAGCTCCCAGCCAGATGGG + Intergenic
920182282 1:204139484-204139506 TAGAGAGTTCCAAGTCTCATTGG - Intronic
920288478 1:204899073-204899095 CAGGGAGCTCCCAGGCTGATGGG + Intronic
921259182 1:213370486-213370508 CTGAGAGCCCCCAGTTTCATGGG + Intergenic
1063299783 10:4841119-4841141 CAGGGAGCTCTCAGACTGACTGG + Intronic
1063837405 10:10031088-10031110 CAGAGGACTGCCTGACTCATGGG + Intergenic
1064007774 10:11712173-11712195 GGGGGAGGTCCCAGACTCATTGG - Intergenic
1064186851 10:13169275-13169297 CAGAGAGGTCCCAGAGAAATGGG - Intronic
1066243334 10:33558792-33558814 CATGGAGCACCTAGACTCATGGG + Intergenic
1066493355 10:35916781-35916803 CAGGGAGCTTGCAGTCTCATTGG + Intergenic
1068557003 10:58469327-58469349 CAGAGAGCTCCCAGCTTAACAGG - Intergenic
1068932969 10:62610456-62610478 CAGAGGGCTACCAGGCCCATAGG + Intronic
1069038589 10:63671072-63671094 CAAAGAGCTCACAGTCTAATTGG - Intergenic
1070756179 10:78994719-78994741 CAGGGAGCTTCTAGTCTCATTGG + Intergenic
1073597006 10:104811248-104811270 CAAAGAGGTCCCAGCTTCATGGG + Intronic
1075007449 10:118841014-118841036 TAGAAAGCTCCCAGCCTCAAGGG + Intergenic
1075550867 10:123391339-123391361 CAGAGAGCTCCCATTCTCCCAGG - Intergenic
1078045309 11:7909029-7909051 CTGATAGCTCCAATACTCATAGG + Intergenic
1078187192 11:9062062-9062084 CAGAGAGGTACCAGGCTCAAGGG + Intronic
1080521683 11:33072969-33072991 GAGAGAGGTCCCAGCCTCCTTGG - Exonic
1081765735 11:45608751-45608773 CAAGGAGCTCACAGACTGATAGG - Intergenic
1084167704 11:67383729-67383751 CACAGAGGGCCCAGAATCATGGG + Intronic
1084324158 11:68389832-68389854 CAGAGACCAGACAGACTCATGGG + Intronic
1084639484 11:70416042-70416064 AAGAGAGCTCACAGATTGATCGG + Intronic
1085393152 11:76192876-76192898 CAGAGACCTGCAAGAGTCATGGG + Intronic
1086372035 11:86164649-86164671 CAGAGAGCTCACAGCCTAGTGGG + Intergenic
1087210892 11:95445916-95445938 CAGAGAGGCCCCAGTGTCATAGG + Intergenic
1087673877 11:101136601-101136623 CTGGCAGCTCCCAGACTCCTGGG + Intergenic
1090420004 11:126568176-126568198 AAGAGAGAGCCCAGACTCCTGGG - Intronic
1090941591 11:131392502-131392524 CACAGACCTCCCTGGCTCATGGG + Intronic
1092054874 12:5500527-5500549 GAGGGAGATGCCAGACTCATGGG + Intronic
1092449111 12:8585365-8585387 CAGACAGATCTCAGACTCCTGGG - Intergenic
1096543304 12:52320762-52320784 CCGGGAGCTACCAGACTGATGGG - Intronic
1098459386 12:70715497-70715519 CATAGCGCTCCCAGGCTTATTGG - Intronic
1098553381 12:71790789-71790811 CAAAGAGCTCCTAGACACGTTGG - Exonic
1101203417 12:102460749-102460771 CAGTGATATCCCTGACTCATTGG - Intronic
1101851261 12:108404168-108404190 TAGAGAGCTCCAGGACACATCGG - Intergenic
1102525715 12:113511220-113511242 CAAAGAGCTTACAGTCTCATGGG - Intergenic
1103042776 12:117709603-117709625 CAGAGAGCTGCCAGGCACAGTGG - Intronic
1103150299 12:118632451-118632473 CAGGGAGCTCACAGTCTCCTAGG + Intergenic
1103266409 12:119634278-119634300 CAGAAAACTCACAGATTCATGGG - Intronic
1107614402 13:42149447-42149469 CAGAGAGCTCACAGTCCAATGGG - Intronic
1115070170 14:29312691-29312713 CAGAGAGCTCACAGTCTAGTGGG + Intergenic
1117051834 14:51868072-51868094 CTAAGAGCTCACAAACTCATGGG + Intronic
1119512420 14:75222040-75222062 CAGAGAGCCCCCAGTCTCTGGGG + Intergenic
1119519519 14:75275874-75275896 CAGAGAGATTCCAGTCTCATAGG - Intergenic
1119964427 14:78898222-78898244 CGGAGAGCTCCCAAGCTAATTGG + Intronic
1120807290 14:88766472-88766494 CATAGCGCTCCCAGGCTTATTGG + Intronic
1121731889 14:96193077-96193099 CAGCCAGCTCCCAGATGCATTGG + Intergenic
1126605024 15:50467765-50467787 CAGACAGCTCTCAAACTCCTGGG + Intronic
1127730980 15:61801728-61801750 CAGAGAGCACCAGGACTCATGGG - Intergenic
1127901071 15:63341390-63341412 CAGAGGCCTCCCATTCTCATAGG + Intronic
1128643870 15:69360609-69360631 CTGTGAGCTCCCAGGCCCATGGG - Intronic
1128648240 15:69392597-69392619 CAGAGAGCACCCAGTGCCATAGG + Intronic
1128698265 15:69785157-69785179 TAGATAGCTTGCAGACTCATTGG - Intergenic
1128751359 15:70152408-70152430 CAGAGAGCTACCAGTCTCTCTGG - Intergenic
1128791670 15:70438913-70438935 CAGAGAGCTCCCAGCCAGCTGGG - Intergenic
1129813768 15:78533645-78533667 CATGGAGATCCCAGATTCATAGG - Exonic
1131530733 15:93189731-93189753 CAGAGGCCTCCCAGAATGATAGG + Intergenic
1132405384 15:101539007-101539029 CAGAGACCTGCCAGGCTCAAGGG - Intergenic
1133025852 16:2988675-2988697 CAGAGAGCTCCCACACCCCCAGG - Intergenic
1133658015 16:7885617-7885639 CTTAGAGCTCCCTGCCTCATTGG - Intergenic
1134239835 16:12497358-12497380 CAGAGAGTTCACAGTCTCATAGG + Intronic
1134264333 16:12680551-12680573 CAGAGAGCATCCAGATTCAGGGG + Intronic
1134571963 16:15298795-15298817 CAGAAAGCCCCAAGACTTATGGG - Intergenic
1135296874 16:21287383-21287405 CACAGAGCTCCCACAGTCCTTGG + Intronic
1135535771 16:23293202-23293224 CAGTGAACACCCATACTCATAGG + Intronic
1136136915 16:28261880-28261902 CAGAGAGTCCCCAGAATCAGAGG - Intergenic
1138380739 16:56600636-56600658 CGGGGAGCTCACAGACTGATGGG + Intergenic
1139259960 16:65582167-65582189 CACAGAGCTCCTAAACTCCTTGG + Intergenic
1139530640 16:67540955-67540977 CATAGAGGTCACAGCCTCATGGG - Intronic
1139734058 16:68972203-68972225 CAGAGATTTCCCAGGCTCTTTGG + Intronic
1142134161 16:88444027-88444049 CAGAGAGCTCCCATAGACAGCGG + Intergenic
1142544684 17:692110-692132 CAGTAAGCTCTCAGACTCACAGG - Intronic
1142622889 17:1176156-1176178 CAGAGAGCCACCAGCCTCAGTGG + Intronic
1143862085 17:9898390-9898412 CAGGGAGCTCCAAGGGTCATGGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1145009295 17:19358407-19358429 CAAAGAGCTGCCACACTCACCGG + Intronic
1145909852 17:28536169-28536191 CAGAGAGCTCCCAACCCGATGGG + Intronic
1146919909 17:36703605-36703627 CAGGGAGCTCCCAGACCACTGGG + Intergenic
1147169538 17:38609888-38609910 CAAGGAGCTCCCAGTCTGATGGG - Intergenic
1147463424 17:40590808-40590830 CAGGGAGCTCCCAGAGTGATAGG + Intergenic
1148720167 17:49746731-49746753 CAGAGAGATCCCAGAGACAGAGG + Intronic
1148903843 17:50899083-50899105 CACAGAGCTCATAGCCTCATGGG + Intergenic
1149666549 17:58368886-58368908 CAGGTAGCTCAAAGACTCATAGG + Intronic
1152147984 17:78580695-78580717 CCCAGAGCTCCCAGACACAGGGG + Intergenic
1152211079 17:79003753-79003775 CAGCTATCTCCCAGACTCAGGGG + Intronic
1155444850 18:25900238-25900260 TAGAAAAGTCCCAGACTCATGGG - Intergenic
1156362816 18:36399351-36399373 GAGACAGCTCACAGACCCATAGG - Intronic
1156616997 18:38799177-38799199 CAGAGAGCCCCCCGACCCACAGG + Intergenic
1157181437 18:45501757-45501779 CAGAGTGGTCCCAGAGTCTTGGG + Intronic
1158947717 18:62462067-62462089 CAGAGTGTGTCCAGACTCATAGG + Intergenic
1159766441 18:72495466-72495488 CAAAAAGCTGCCAGATTCATGGG + Intergenic
1160323052 18:77914407-77914429 CAGAGAGCTCTCAGGCACATGGG + Intergenic
1160899652 19:1421360-1421382 CAGCGAGCTCCCAGCCTGAAAGG - Intronic
1164378729 19:27712672-27712694 CATAGTGCTCCCAGGCTTATTGG - Intergenic
1165199160 19:34131421-34131443 CAGAGTGGTCTCAGACTCCTAGG + Intergenic
1165792411 19:38500183-38500205 CACAGAGCTCCCAGTCCAATGGG + Intronic
1166251847 19:41576778-41576800 CACAGAGCTCACAATCTCATGGG + Intronic
1166452905 19:42916952-42916974 CACAGAGCTCACACTCTCATGGG - Intronic
1166670857 19:44708853-44708875 CTAAGAGCTCCCAGTCTGATGGG - Intronic
1167566046 19:50257747-50257769 CAGGGAGCTCACAGTCTGATGGG + Intronic
1168498964 19:56877401-56877423 CACAGAGCTGACAGTCTCATGGG + Intergenic
925965820 2:9064873-9064895 CAACCAGCTCCCAGTCTCATGGG - Intergenic
926314550 2:11699753-11699775 TAGGGAGCTCCCAGCCTAATGGG + Intronic
926702187 2:15811027-15811049 CAGAGAGCTCCCCGGGGCATGGG + Intergenic
928625054 2:33131101-33131123 CACAGAGATCCAAGACTCACAGG - Intronic
929567993 2:43001710-43001732 CAGAGAGCTCCCAGTCTAGTAGG + Intergenic
930057718 2:47264837-47264859 CAGAAAGCACCCTGACTGATGGG + Intergenic
930330225 2:49974098-49974120 AGGAGAGCTCCCTGACTCAGTGG + Intronic
931044518 2:58335806-58335828 CAAAGAGCTCACAGTATCATGGG + Intergenic
931976553 2:67649988-67650010 TAGAGGGCTCACAGACTCACGGG - Intergenic
932459503 2:71873184-71873206 CAGGGAGCCCCTAGACTGATAGG - Intergenic
939107735 2:137969155-137969177 CAGAGAGGTACCAGAGTAATTGG - Intronic
939960132 2:148558969-148558991 CCGACAGCTCCCTGACTCTTTGG + Intergenic
945223568 2:207508868-207508890 CATAGAGCTTCCAGACCAATAGG - Intergenic
946907364 2:224429822-224429844 CAGAGAAATCCTAGACTTATAGG + Intergenic
1174970062 20:55264850-55264872 CTGAGAGCTGCCAGACTCTCTGG - Intergenic
1175344284 20:58260811-58260833 CAGAGAGCCCCCAAACACATCGG + Intergenic
1176155911 20:63620348-63620370 CAGGGAGCCCCCACACTCTTGGG - Intronic
1177576197 21:22959585-22959607 CATAGATCTCCCAGAAACATAGG + Intergenic
1178032751 21:28546448-28546470 CAGGGAGCTCCAGGTCTCATTGG - Intergenic
1178297607 21:31423560-31423582 CAGAGAGCTCACAGGCTTGTGGG - Intronic
1179632938 21:42689745-42689767 CAGAGAGCTTCCAGACATTTGGG - Intronic
1181491728 22:23264395-23264417 AAGAGAGGTCCCTGACTCACTGG - Intronic
1182457358 22:30460456-30460478 CAGAGACCTCCCAGCCCCCTTGG + Intronic
1183056641 22:35310805-35310827 TAAAGAGCTCACAGACTCCTGGG + Intronic
1183779442 22:39989323-39989345 CACAGACCTTCCAGACTCAGGGG - Intergenic
1184075024 22:42171272-42171294 CAGAGAGCTCCCAGGCACCATGG + Intronic
950264402 3:11563497-11563519 CAGGGAGCTCCCAGTCTAATTGG - Intronic
953168003 3:40482383-40482405 CAGAATGCTCCCAGAGTCACTGG - Intronic
954708436 3:52493470-52493492 CAGAGAGATCCCAGAGTCTGAGG + Intergenic
954894636 3:53965053-53965075 CAGAGAGCTTCCATAATCACAGG + Intergenic
955629185 3:60953671-60953693 CAGAGAGACCCTAGAGTCATTGG - Intronic
956046439 3:65200761-65200783 CAGAGAGGTCCCAAGCTCAAAGG - Intergenic
956177223 3:66484373-66484395 CAGGGAGCTTACAGACTAATGGG + Intronic
956499393 3:69865813-69865835 CCGAGAGCTCCCAAACTGAGAGG + Intronic
957704476 3:83761814-83761836 CAGAGAGGTCTCAAACTCCTAGG + Intergenic
960938705 3:122919650-122919672 CAGTTTGCTCCCAGACTCCTGGG + Intronic
960942783 3:122945602-122945624 TAGGGAGCACCCAGTCTCATAGG - Intronic
961016698 3:123473966-123473988 CAGCCAGCTCCCAGACTCCAGGG - Intergenic
962684267 3:137831530-137831552 CAGAGTGCGCCCAGATTCAAAGG + Intergenic
962747539 3:138408430-138408452 CACAGGGTTCCCAGCCTCATGGG + Intergenic
963452291 3:145497612-145497634 CAGAGAGTTTCTAGACTCAGAGG - Intergenic
964700567 3:159561374-159561396 AAGAAAGATCCCAGTCTCATGGG - Intronic
965729494 3:171755703-171755725 CAGGGAGCTCCCAGTCTTTTAGG - Intronic
966585964 3:181624642-181624664 CAGAGAGCTCCCAGAGAGACAGG - Intergenic
967298582 3:187989911-187989933 CACAGAGCTCCCAGACAGAGCGG - Intergenic
968742825 4:2339972-2339994 CAGGGAGCCCCCAGACCCAAGGG - Intronic
969215441 4:5718902-5718924 CAAAGAGCTCCCAGTCCAATGGG + Intronic
969525139 4:7700457-7700479 CAGAGAGGACCCAGACCAATGGG + Intronic
973791974 4:54386134-54386156 CAGAGAGCTCAAACACTCGTTGG - Intergenic
975435667 4:74348505-74348527 CAGCCAAATCCCAGACTCATGGG - Intergenic
975709526 4:77146236-77146258 CAGAGAGCTCAGAGCCTAATGGG - Intergenic
977483995 4:97618403-97618425 CAGTCAACTCCCAGAATCATGGG + Intronic
979512905 4:121574321-121574343 CAGAGAGATTCCAGAGTCAGAGG - Intergenic
979618587 4:122772516-122772538 CAGACAACTCACAGAATCATAGG - Intergenic
986476090 5:8134906-8134928 CAGAGTGATCTCAGACTCACGGG - Intergenic
987114136 5:14713211-14713233 CAGGGAGCTCCCAGCGTCCTGGG - Intronic
988659693 5:33252025-33252047 CAGGTAGCTCTTAGACTCATAGG - Intergenic
993808899 5:92449941-92449963 CAGAGAGATATCAAACTCATAGG - Intergenic
994673599 5:102793311-102793333 CAGACTGCTCCCAAACTCCTGGG - Intronic
997747079 5:136308776-136308798 CAGGGAGCTCACAGACACAGTGG - Intronic
999306609 5:150523670-150523692 CACAGAGCTCCCACAGTCTTTGG + Intronic
1000415474 5:160979735-160979757 CACAGAGCTCACAGTTTCATGGG + Intergenic
1002198656 5:177514557-177514579 CAAGGAGCTCCCAGTCTAATGGG - Intronic
1002326918 5:178415761-178415783 CAGAGAGCTCCCAGCCTAGCGGG + Intronic
1002518831 5:179778934-179778956 CGCAGAGCTCACAGTCTCATGGG + Intronic
1003606710 6:7568548-7568570 CAGAGAGCTCTGAGAATAATGGG - Exonic
1005094439 6:22098627-22098649 CAGGGAGCTTACAGTCTCATGGG - Intergenic
1006409192 6:33862609-33862631 CAGGGAGCTCCCAGCCTGGTTGG - Intergenic
1006924374 6:37646386-37646408 CAGAGAGTTCCCAGATGCCTAGG + Intronic
1007302784 6:40880766-40880788 TAGAGAGCTCACAAAATCATTGG + Intergenic
1007380608 6:41488113-41488135 CTCAGCGCTCCCAGGCTCATGGG + Intergenic
1007749799 6:44064902-44064924 CAGTGAGCTCCCAGTCTGACAGG + Intergenic
1013218061 6:108048600-108048622 CAGACAGCTCTTAGACCCATCGG - Intronic
1013714744 6:112945304-112945326 CAGACAACTCCCAAAATCATGGG - Intergenic
1014170488 6:118274063-118274085 CAGTGAGAACCCAGGCTCATCGG + Intronic
1019784977 7:2970903-2970925 AAAAGGGCCCCCAGACTCATTGG + Intronic
1020677544 7:11198844-11198866 CAGAGGACTCCAAGATTCATGGG + Intergenic
1023733223 7:43211478-43211500 CAGGGAACTCACAGTCTCATGGG + Intronic
1029520899 7:101061537-101061559 GACAGAGCACCCAGACCCATAGG + Intergenic
1029699173 7:102235270-102235292 CAGTGAGCTCCCAGCACCATAGG - Intronic
1034162611 7:149004255-149004277 GAGAGAGCCCCCAGAATCTTTGG - Intronic
1035630352 8:1102931-1102953 CAGAGACCCCAGAGACTCATAGG - Intergenic
1037475098 8:19249285-19249307 CAGAGGGCTTCCAGATTTATTGG + Intergenic
1037799241 8:22023613-22023635 CAAAGGGCTTCCAGCCTCATTGG - Intergenic
1039734164 8:40312843-40312865 CTGAGAGTTCCCAGTCTCATAGG + Intergenic
1040822248 8:51574681-51574703 AAGAGAGCTCAAAGAATCATAGG + Intronic
1041437226 8:57855598-57855620 CAGAGAGCTGTGAGACTCACCGG - Intergenic
1041679559 8:60574958-60574980 TGGAGAGCTCCCAGACCCAATGG + Intronic
1043246440 8:78008870-78008892 CTGAGTGCTTCCAGAGTCATGGG - Intergenic
1043420101 8:80088980-80089002 CAGAGAGCTGCCAGGCGCAGTGG - Intronic
1043946672 8:86261434-86261456 CAGGGAGCTCACAGAATCACAGG - Intronic
1045035408 8:98173003-98173025 CAGAGAGGTACCAGGCTCACAGG - Intergenic
1045553785 8:103195852-103195874 CATGGAGCTCCCAGACCAATGGG + Intronic
1046280754 8:112027155-112027177 CAGATATCTCACAGACTAATGGG - Intergenic
1046440892 8:114252941-114252963 AAGAGAGCTCCTAAACTGATGGG - Intergenic
1048205959 8:132415419-132415441 CAGAGAGCTCCCAGACTCATGGG - Intronic
1048387196 8:133922797-133922819 CAGAGACATCCCAGATTCAAGGG + Intergenic
1048593418 8:135842566-135842588 CAGAGAGATTCCTGTCTCATTGG - Intergenic
1049646226 8:143737005-143737027 CAGAGAGCTCCCAGATTCACAGG + Intergenic
1050632979 9:7580347-7580369 CACAAAGCTCACAGTCTCATGGG - Intergenic
1051565749 9:18496080-18496102 CAAAGAGCTTCCAGTCTAATTGG + Intronic
1051605623 9:18915327-18915349 CAGGGAGCTCACAGTCTAATTGG + Intergenic
1051924274 9:22304757-22304779 CAGTGAGGTCCCACACTCTTTGG - Intergenic
1052986346 9:34490872-34490894 CAGAAAGTTCCCTGACTCAGAGG + Intronic
1058609777 9:106763041-106763063 CAGAGCGACCCCAGACTCAGAGG + Intergenic
1060815205 9:126631543-126631565 CAGAGAGCTCCCAGGCTAAGTGG + Intronic
1061117734 9:128625315-128625337 CAGGGAGCTTCCAGACTAACTGG + Intronic
1062102330 9:134734729-134734751 CAGGAAGCCCCCAGACTCAGTGG + Intronic
1186082518 X:5948796-5948818 CAGTCAGCTCACAGAATCATGGG - Intronic
1186694507 X:12015914-12015936 CACAGAGCCACCATACTCATTGG + Intergenic
1190283471 X:48946701-48946723 CAGCCATCTCCCAGAGTCATGGG + Intronic
1190915811 X:54810354-54810376 CAGAGAGCTTGCAGACTGATGGG + Intronic
1192136975 X:68611915-68611937 CAGACTGGTCCCAGACTCCTGGG + Intergenic
1192299080 X:69881401-69881423 CAAGGTGGTCCCAGACTCATAGG + Intronic
1193520484 X:82523604-82523626 CAGACAGCTCTCAGACTCTGGGG + Intergenic
1193594746 X:83432600-83432622 CATAGCGCTCCCAGGCTTATTGG + Intergenic
1200230553 X:154441856-154441878 CAGGGAGCTCCCACACTGATGGG - Intronic