ID: 1048206727

View in Genome Browser
Species Human (GRCh38)
Location 8:132421524-132421546
Sequence CGACCCACACACCCTAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048206727_1048206743 20 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206743 8:132421567-132421589 CACTTGGGGCAGATGGTGGGTGG No data
1048206727_1048206735 -7 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206735 8:132421540-132421562 TGGGTCGGGGGAACAAAATGGGG No data
1048206727_1048206741 16 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206741 8:132421563-132421585 GATTCACTTGGGGCAGATGGTGG No data
1048206727_1048206733 -9 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206733 8:132421538-132421560 TGTGGGTCGGGGGAACAAAATGG No data
1048206727_1048206740 13 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206740 8:132421560-132421582 GGGGATTCACTTGGGGCAGATGG No data
1048206727_1048206739 6 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206739 8:132421553-132421575 CAAAATGGGGGATTCACTTGGGG No data
1048206727_1048206742 17 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG No data
1048206727_1048206737 4 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206737 8:132421551-132421573 AACAAAATGGGGGATTCACTTGG No data
1048206727_1048206738 5 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206738 8:132421552-132421574 ACAAAATGGGGGATTCACTTGGG No data
1048206727_1048206734 -8 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206734 8:132421539-132421561 GTGGGTCGGGGGAACAAAATGGG No data
1048206727_1048206736 -6 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206736 8:132421541-132421563 GGGTCGGGGGAACAAAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048206727 Original CRISPR CGACCCACACACCCTAGGTC AGG (reversed) Intronic
904030366 1:27529638-27529660 TGACCCTCACACCTTAGGACGGG - Intergenic
917504302 1:175614324-175614346 TGAGCCAGGCACCCTAGGTCAGG + Intronic
922617000 1:226966578-226966600 CTAACCACTCACCCAAGGTCAGG - Intronic
1066065629 10:31759514-31759536 CGCCCCACACACCGCAGGACAGG + Intergenic
1073115391 10:101088810-101088832 AGACCCCCACCCCCTAGGTGTGG - Intergenic
1074536753 10:114333508-114333530 CTGCCCCCACACCCTCGGTCAGG - Intronic
1077782693 11:5348714-5348736 AGACCCACCCACCCTCCGTCTGG - Intronic
1080260875 11:30348361-30348383 GGACACTCACACCCCAGGTCTGG + Intergenic
1083900347 11:65640534-65640556 CCACCCACACACCTTAGCTTTGG - Intronic
1086203033 11:84226429-84226451 CGACTCACACATCCTAATTCAGG + Intronic
1096179457 12:49542646-49542668 GTGCCCACACACCCTAGCTCCGG - Intronic
1108090634 13:46846043-46846065 TGTCCCACACAGCCTAGGTAGGG + Intronic
1120527527 14:85594455-85594477 CAACTCACATACCCTAGGTGCGG + Intronic
1122704849 14:103614241-103614263 CCTCCCACACAGCCGAGGTCAGG - Intronic
1123701377 15:22917080-22917102 CGACACACACACCCCAGGCAGGG + Intronic
1136636979 16:31530125-31530147 CCACCCACACACACCAGGCCAGG - Intergenic
1137855755 16:51792980-51793002 ACACACACACACACTAGGTCTGG + Intergenic
1142612504 17:1116922-1116944 TGAACCACACAACCCAGGTCCGG + Intronic
1152042779 17:77915327-77915349 GGAACCACACTCCCTTGGTCTGG - Intergenic
1152163203 17:78682566-78682588 CCACCCACACACCCTTTCTCAGG - Intronic
1152252347 17:79218632-79218654 CGGCTCACACACGCCAGGTCAGG + Intronic
1153344952 18:4015376-4015398 GGATCCACACACCCTAAGTTGGG + Intronic
1157207701 18:45714630-45714652 AGACACACACACCCTATCTCAGG + Intergenic
1162298222 19:9828030-9828052 CGACCCAGCCACCCAGGGTCTGG + Exonic
1166380746 19:42353907-42353929 CAACCCACACACAGTAGGACAGG - Exonic
1168389608 19:55995202-55995224 CCAGCCCCACACCCTAGGACAGG - Intergenic
1168669390 19:58229328-58229350 CGACCCAGGCACCCTCTGTCGGG - Intronic
926209804 2:10861520-10861542 CAACCTGCACACCCTAGGGCAGG - Intergenic
929784035 2:44976196-44976218 CGGCTCACACACCCTTGGCCAGG + Intergenic
946539137 2:220664571-220664593 CATCCCACACATACTAGGTCTGG - Intergenic
946726796 2:222669757-222669779 CTACGAACACACCCTATGTCAGG - Intergenic
1172979394 20:38929437-38929459 CAGCCCCCATACCCTAGGTCTGG - Intronic
1173562989 20:44019626-44019648 CAACACACACACCCTATGACAGG - Intronic
1175815361 20:61880681-61880703 CGACCCTCACCCCCAAGGCCAGG - Intronic
949382284 3:3459757-3459779 CAACCCCCACCCCCAAGGTCTGG - Intergenic
952706445 3:36381904-36381926 TGACACACATACCCCAGGTCTGG - Intronic
953405402 3:42657340-42657362 AGACCCCCAGACCCCAGGTCAGG - Intronic
953668329 3:44942041-44942063 CCAACCACACACCATAGGGCTGG + Intronic
965954296 3:174349743-174349765 AGACCCACACAGCCTAGAGCAGG + Intergenic
968127070 3:196167901-196167923 CGACCCAAAACCCCAAGGTCGGG + Intergenic
979715947 4:123838326-123838348 TGACCCAGAAACTCTAGGTCTGG - Intergenic
985244659 4:187968267-187968289 CTACCCAGACACCTTAGGTCAGG - Intergenic
987415311 5:17655718-17655740 CGACCCACAGACCTGAGGGCTGG - Intergenic
999099971 5:149015427-149015449 CCACCCACAGACTCTAGGTTTGG + Intronic
999371583 5:151058576-151058598 GAACCCACACACACCAGGTCTGG + Intronic
1001223507 5:169924218-169924240 CCAGCCACACACACTAGCTCTGG + Intronic
1002067290 5:176658210-176658232 AGCCCCACACTCCCTGGGTCTGG + Exonic
1015856660 6:137632297-137632319 AGACCAACACAGCCTAGGCCAGG + Intergenic
1015891713 6:137976555-137976577 TCACACACACACCCTATGTCAGG + Intergenic
1017669610 6:156757410-156757432 TGTCCCACACAGCCTAGGTGTGG + Intergenic
1018205095 6:161429684-161429706 CCTCCCACACACCCTCGGACTGG - Intronic
1048206727 8:132421524-132421546 CGACCCACACACCCTAGGTCAGG - Intronic
1049243054 8:141548520-141548542 CACCCCATCCACCCTAGGTCCGG + Intergenic
1056941721 9:90961796-90961818 CCACCCAGACACCCAAGGCCAGG - Intergenic
1190731616 X:53230206-53230228 CCACCCACACACCCCAAGTTGGG + Intergenic
1192875509 X:75225355-75225377 ACACACACACACCCTAGGTGGGG + Intergenic