ID: 1048206732

View in Genome Browser
Species Human (GRCh38)
Location 8:132421529-132421551
Sequence TCCCCCGACCCACACACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048206732_1048206744 29 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206744 8:132421581-132421603 GGTGGGTGGTAACAGATGACAGG No data
1048206732_1048206737 -1 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206737 8:132421551-132421573 AACAAAATGGGGGATTCACTTGG No data
1048206732_1048206742 12 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG No data
1048206732_1048206741 11 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206741 8:132421563-132421585 GATTCACTTGGGGCAGATGGTGG No data
1048206732_1048206740 8 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206740 8:132421560-132421582 GGGGATTCACTTGGGGCAGATGG No data
1048206732_1048206738 0 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206738 8:132421552-132421574 ACAAAATGGGGGATTCACTTGGG No data
1048206732_1048206739 1 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206739 8:132421553-132421575 CAAAATGGGGGATTCACTTGGGG No data
1048206732_1048206743 15 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206743 8:132421567-132421589 CACTTGGGGCAGATGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048206732 Original CRISPR TCCCCCGACCCACACACCCT AGG (reversed) Intronic
900285655 1:1899137-1899159 TCCCCCGGCCCACCCACCCATGG + Intergenic
900580058 1:3404438-3404460 GACCCCGGCCCACACTCCCTGGG - Intronic
901787997 1:11637395-11637417 TTCCTCACCCCACACACCCTGGG - Intergenic
902465433 1:16614458-16614480 TCCCTCGACCCTCACTCCCCAGG - Intergenic
902672286 1:17983211-17983233 TGCCCCGACCCCCAGCCCCTGGG + Intergenic
904369780 1:30040983-30041005 TCTCCCCACCTACCCACCCTGGG + Intergenic
906537567 1:46560160-46560182 TCCCCCGGCCCCCACCCCCATGG + Intronic
915101992 1:153507390-153507412 ACCCCCCACACACACACCCAAGG + Intergenic
915506030 1:156357049-156357071 TCCCCCGAACACCTCACCCTAGG - Intronic
919022808 1:192129971-192129993 TCCCCTGACAGACACACCATTGG - Intergenic
922743769 1:228031480-228031502 TCACACGCCACACACACCCTTGG - Intronic
922799850 1:228360219-228360241 TCCCAGGACACACACAGCCTTGG + Intronic
1066065624 10:31759509-31759531 CCCCCCGCCCCACACACCGCAGG + Intergenic
1067227757 10:44386546-44386568 CCCACCCACCCACCCACCCTGGG + Intergenic
1070290095 10:75108397-75108419 TCCCCCGACACACACACCGCCGG - Intronic
1070678868 10:78434911-78434933 TCCACCATCCCACACACCCAGGG - Intergenic
1070843207 10:79502493-79502515 TCACCAGATCCACACACCCCGGG - Intergenic
1073061144 10:100734595-100734617 TACCCCTACCCACATACCCTGGG - Intergenic
1074499774 10:114012858-114012880 TCCCCCAACCCACCCACCAATGG + Intergenic
1075325374 10:121527734-121527756 TCTCCTGACCCACACACACTAGG + Intronic
1075589898 10:123683921-123683943 TCTCCAAACCCACACACCCCAGG + Intronic
1076078279 10:127554925-127554947 TGCCCCACTCCACACACCCTGGG - Intergenic
1076835956 10:133021009-133021031 TCCCCAAACACACACACCCTTGG - Intergenic
1080755096 11:35189650-35189672 TCCCATCCCCCACACACCCTGGG - Intronic
1081573634 11:44306361-44306383 TTCCCCGCCCCGCACTCCCTCGG + Intronic
1083273702 11:61585247-61585269 TCCCCCTACCCCCACCCCCTTGG + Intergenic
1083602059 11:63954820-63954842 TCCCCTGACACATACACACTTGG + Exonic
1083948326 11:65938954-65938976 TCCACCCACCCACTCCCCCTTGG - Intergenic
1084562315 11:69911811-69911833 TCCCCCAACACCCCCACCCTGGG - Intergenic
1084679863 11:70660644-70660666 TCTCCACACCCACCCACCCTTGG - Intronic
1087253003 11:95924235-95924257 TCACCAGACCCCCTCACCCTGGG - Exonic
1087369140 11:97259281-97259303 TCCTCAGTCCCACATACCCTAGG - Intergenic
1089214119 11:116825415-116825437 GCCCCCCAGCCACACTCCCTGGG + Intergenic
1091799780 12:3317450-3317472 CCCCCAGACCCCCACAGCCTTGG - Intergenic
1094174195 12:27524614-27524636 TCCTTAGACCCCCACACCCTAGG + Intronic
1095944600 12:47746738-47746760 TCCTCCCACAGACACACCCTTGG - Intronic
1096159971 12:49367758-49367780 TCACCCGCCCCACAGACCCCAGG - Intronic
1096259680 12:50082869-50082891 TCCCCCAACCCGGGCACCCTCGG + Exonic
1096500600 12:52062076-52062098 TCCCCCACCCCACCCACGCTGGG + Intergenic
1100620608 12:96268929-96268951 TCCCCCCACCCCCACCCCATAGG + Exonic
1105389077 13:19958782-19958804 TCCCCCGGCCCACCCCCCTTCGG - Exonic
1105881137 13:24607352-24607374 CCGCCCCACACACACACCCTGGG - Intergenic
1106140385 13:27006521-27006543 TCCCCCCACCCCCACCCCCCGGG + Intergenic
1107935387 13:45341455-45341477 TCCCCCGCTCCACCCACCCAGGG - Intergenic
1111556147 13:89883954-89883976 TCCCCCCACCCACCCGCCGTGGG - Intergenic
1113423943 13:110192514-110192536 CCCCCCTGCCCACACACCCAGGG + Intronic
1113677452 13:112216293-112216315 TCCCCCGGCCCACAATCCCCTGG - Intergenic
1113708855 13:112451479-112451501 CCCCCTGACCCACACACCCTCGG - Intergenic
1113804966 13:113107235-113107257 TCCCGGGACACCCACACCCTTGG - Intronic
1113935379 13:113991248-113991270 TCTCCAGCCCCACACGCCCTGGG - Intronic
1114510902 14:23259607-23259629 TCCACCCACACACACACCCCTGG - Intronic
1114664432 14:24369580-24369602 TTCCCCGACCTCCACCCCCTCGG + Exonic
1116341216 14:43725784-43725806 TCCCTCGACACACACACACCAGG + Intergenic
1116465609 14:45229126-45229148 TCCCCCCACCCCCACCCCCAGGG - Intronic
1117540936 14:56745962-56745984 TCCCCACATACACACACCCTAGG + Intergenic
1118142660 14:63101615-63101637 GCCCCCACCCCACACACCATCGG - Intronic
1121320649 14:92989777-92989799 TCCCCACACCCGCACCCCCTAGG - Intronic
1122181721 14:99960016-99960038 TTTCCCCACCCACACCCCCTTGG + Intergenic
1122616250 14:103020007-103020029 TCCTCAGACCCTCCCACCCTGGG - Intronic
1122791748 14:104186852-104186874 TCCCCCGCCCCCCACACGCGTGG + Intergenic
1123701375 15:22917075-22917097 TCACTCGACACACACACCCCAGG + Intronic
1125611890 15:40976976-40976998 TCCCCCAACCCCCACCCCCGTGG - Intergenic
1126495474 15:49285355-49285377 TCCCTCCACCGACCCACCCTGGG + Intronic
1127048416 15:55052732-55052754 TCCCCTGACCCACAAAACCTAGG + Intergenic
1129192471 15:73945539-73945561 TCCACTCCCCCACACACCCTGGG - Intronic
1130897264 15:88181260-88181282 TCCTCCTACCCACAAAGCCTTGG + Intronic
1131132361 15:89908451-89908473 TCCCACAACACACACACTCTGGG + Intronic
1132396246 15:101476953-101476975 TTCCCCGCCCCACATGCCCTGGG - Intronic
1132843743 16:1990606-1990628 TTCCCCCGCACACACACCCTCGG + Intronic
1133040531 16:3058103-3058125 CCCACCCAGCCACACACCCTGGG + Intronic
1134172607 16:11980171-11980193 TCCCCCTCCCCTCAGACCCTGGG + Intronic
1136993143 16:35169478-35169500 TCCCCCGACCCACTCAGCGATGG - Intergenic
1138104839 16:54282483-54282505 TCCCCCGGCCCGCCCACCCCAGG + Intergenic
1138283121 16:55787042-55787064 ACGCCCCACCCACACAGCCTTGG - Intergenic
1138563331 16:57815267-57815289 TCCCAGGACCCCCACAGCCTTGG - Intronic
1138834908 16:60422152-60422174 TCCCCAGAGCCAAAGACCCTAGG - Intergenic
1141141150 16:81497627-81497649 TGCCCAGGCCCAGACACCCTCGG - Intronic
1142242236 16:88952858-88952880 CCCCCCCACCCCCACACCCTGGG + Intronic
1142673713 17:1500226-1500248 TCCCCAGACCCACTCCACCTTGG + Intronic
1146661779 17:34669690-34669712 GCCCCTGACCCACAGTCCCTTGG - Intergenic
1147401108 17:40180478-40180500 TCTCTCCTCCCACACACCCTGGG - Intronic
1148019261 17:44542567-44542589 TGCCCCCACCCCCACCCCCTTGG - Intergenic
1148198684 17:45733401-45733423 TCCCCTGACCCCCACGCCCTTGG + Intergenic
1148473954 17:47914852-47914874 TCCCCAGACTTACCCACCCTGGG - Intronic
1148755282 17:49969867-49969889 TCCCCCCACCCCCACATCCCAGG - Intronic
1149500797 17:57150874-57150896 TCCCCCACACCACACACACTAGG - Intergenic
1150481420 17:65514448-65514470 GCTCCCCACCCACACCCCCTTGG - Intergenic
1151307560 17:73273040-73273062 TCCCCCTGCCCACACTCACTGGG - Intergenic
1151328068 17:73391012-73391034 TCCCCCAATACACACACCCAGGG - Intronic
1151423360 17:74013443-74013465 TCCCCCTACACACACAGCCAAGG - Intergenic
1152042782 17:77915332-77915354 TCCCAGGAACCACACTCCCTTGG - Intergenic
1152210803 17:79002012-79002034 TCTCCCCATCCACACAGCCTCGG + Intronic
1153100429 18:1462198-1462220 TCCACCCACCCACCCACCCTGGG + Intergenic
1153141604 18:1978960-1978982 TCCCCCTCCCACCACACCCTTGG + Intergenic
1153647131 18:7205294-7205316 CCCCCAGACACACACAGCCTTGG - Intergenic
1154218097 18:12430087-12430109 TCCCCGAACCCACACACACGGGG - Intronic
1154355315 18:13619971-13619993 CCCTCAGACCCCCACACCCTAGG - Intronic
1159859580 18:73631516-73631538 TCCCCCACCCCACTCAACCTGGG - Intergenic
1160403053 18:78625019-78625041 TCCCCCGTCCCCCAGAGCCTGGG - Intergenic
1160931093 19:1569760-1569782 CCCCCCGCCTCACACACCCTGGG + Intergenic
1160939484 19:1613707-1613729 CCCCGAGACCCCCACACCCTGGG + Intronic
1161186736 19:2926502-2926524 TCCCCCGACCCACTGCCTCTCGG + Intergenic
1161836971 19:6654415-6654437 TCACCCTACCCCCACCCCCTGGG - Intergenic
1162798403 19:13098265-13098287 CCCCCCACCCCACCCACCCTCGG + Intronic
1163653623 19:18532869-18532891 TCCCACCACCCAAACAGCCTAGG - Intronic
1164654309 19:29909792-29909814 TCCCCAGAATTACACACCCTTGG - Intergenic
1165143950 19:33719667-33719689 TCCCTGGACCCAGACAGCCTGGG - Intronic
1165353635 19:35290976-35290998 TTCCCCGCCCCTCACCCCCTGGG + Intergenic
1165802511 19:38561744-38561766 TCCCCTTACACCCACACCCTGGG + Intronic
1165827287 19:38712648-38712670 ACCCCTGACCCACACTCCCGCGG + Intronic
1166333821 19:42093701-42093723 TTCCCCCACCCACACTCCCCAGG + Intronic
1166376648 19:42331178-42331200 TCCCCCCACCCACAAAGGCTGGG - Intronic
1166749065 19:45156142-45156164 TCCCCCCAGCCACACACCAGAGG + Intronic
1167004816 19:46768721-46768743 TCCCCCGACTGAGACAGCCTGGG + Intronic
1168072212 19:53959571-53959593 TATCCCGACCCTCACTCCCTTGG + Intergenic
1168721204 19:58555872-58555894 TCCCCCGACCCACTCAGCGATGG - Exonic
925868780 2:8251511-8251533 TCCTCTGAACCACCCACCCTGGG + Intergenic
926140932 2:10367688-10367710 TCCCATGACCCACACTCCCATGG + Intronic
926422798 2:12716270-12716292 GCCCCCGATCCCCACATCCTGGG - Intergenic
926506405 2:13721617-13721639 CCCCCCGACCCACAACACCTGGG + Intergenic
927087901 2:19689478-19689500 CCCCCCAACACACACACCCCTGG + Intergenic
927962249 2:27248290-27248312 TCTCCCGTCCCTCACACACTTGG - Intergenic
932404801 2:71505869-71505891 TTCCCTGACCCACACACCACTGG - Intronic
932716595 2:74104787-74104809 TCCCCCAGCCCAAACAGCCTTGG + Exonic
933787615 2:85856410-85856432 TCCCCCTCCCCACAAATCCTAGG - Intronic
934702510 2:96453420-96453442 GGCCCAGGCCCACACACCCTAGG - Intergenic
935181112 2:100691983-100692005 TCTCCAGACCCACAGCCCCTTGG + Intergenic
935919857 2:108001152-108001174 TCCCCCCACCCACACACAAGGGG + Intronic
937332706 2:121042269-121042291 CCCCCCGACCCGCAGACCTTGGG - Intergenic
938399385 2:130976179-130976201 TGCCCTGGGCCACACACCCTGGG - Intronic
938798138 2:134735724-134735746 TCATCTGACCCACACACCCCAGG - Intergenic
941651988 2:168101943-168101965 TCCCCCTACCCACCAGCCCTAGG + Intronic
942277893 2:174336085-174336107 TCCCCCATCCCACCCACTCTAGG + Exonic
942457338 2:176147380-176147402 TCCCCCACTCCACGCACCCTTGG - Intergenic
948422936 2:237871594-237871616 CCCCCCGACCCCAACTCCCTTGG + Intronic
948504847 2:238421895-238421917 TCCCCCGACCCCCACGTTCTAGG + Intergenic
948753768 2:240146859-240146881 GCCCACGGCCCCCACACCCTTGG + Intergenic
1170463020 20:16596838-16596860 TCACCCCACCCCCACTCCCTTGG + Intergenic
1173525486 20:43729469-43729491 TACCCCAACCCACTCACCCTAGG + Intergenic
1173707930 20:45126658-45126680 TCCCCCCACCCCCAGACCCTTGG + Intergenic
1173792011 20:45834009-45834031 CCCCCCAACCCACTCAGCCTAGG - Intronic
1174298736 20:49567698-49567720 GCTCCCCACCCACAAACCCTCGG + Intronic
1174778265 20:53365336-53365358 TCCCCCGACCCCCCCAAGCTGGG - Intronic
1175542230 20:59755041-59755063 TCCCCCTCACCACACACCCTAGG - Intronic
1176177717 20:63736577-63736599 TCCCCTGAGCCTCCCACCCTGGG - Intronic
1176218178 20:63957943-63957965 TCCCCCGACCCTCTGACGCTGGG + Exonic
1176238551 20:64065359-64065381 TCCCACGACCCACAGGCCATGGG - Intronic
1179097470 21:38328427-38328449 TTCCCCCACCCCCACACCCCTGG - Intergenic
1179209751 21:39314348-39314370 TCCCCCGACTCGCACCCCCTCGG - Intronic
1179496787 21:41776801-41776823 CCCCCCCACCCACCCACCCAAGG - Intergenic
1179882006 21:44296802-44296824 TCCCACGCCCCACCCTCCCTGGG - Intronic
1179894013 21:44351345-44351367 TGCCCCAACCCACACTCCCTGGG + Intronic
1180623229 22:17176152-17176174 ACCCCTGACCCACAGACACTGGG + Intergenic
1181049180 22:20230708-20230730 TCCCCTGACTCACAGACCCCAGG + Intergenic
1181388578 22:22562259-22562281 TCCTCCCACCCACAGCCCCTGGG + Intronic
1183385047 22:37509757-37509779 TCCCCCGACCCCCATGCCCATGG + Intronic
1184267912 22:43359637-43359659 TCCCCCGTTCCCCATACCCTTGG - Intergenic
1184645177 22:45891471-45891493 TCCCACGGCCCCCCCACCCTGGG + Intergenic
1185052262 22:48559987-48560009 TGCCCAGACCCTCACACCCACGG - Intronic
1185176242 22:49328588-49328610 CCCCAGGGCCCACACACCCTTGG - Intergenic
950858561 3:16127605-16127627 TTCCCCCACCTGCACACCCTGGG - Intergenic
954151556 3:48660195-48660217 TCACCAGACCCACACCCCCCTGG + Exonic
955275852 3:57546140-57546162 TCCCCCGACCCCGCTACCCTGGG - Intergenic
959735951 3:109658801-109658823 CCCCCCAACCCCCAGACCCTGGG - Intergenic
960713011 3:120549795-120549817 AACCCCCACCCACCCACCCTGGG - Intergenic
961473312 3:127131997-127132019 TACCCCCACCCAGACACCCAGGG - Intergenic
961819167 3:129566497-129566519 CCCCACGACCCACACACAGTGGG - Intronic
966618085 3:181933775-181933797 TCTCCCCCCCCACCCACCCTTGG - Intergenic
967165146 3:186773502-186773524 TGCCCCCACACACACACCATGGG + Intergenic
968009042 3:195260973-195260995 TCCCCACACCCACAGCCCCTTGG + Intronic
968673647 4:1865417-1865439 TCCCCCCACACACACACACCAGG - Intergenic
968808316 4:2788816-2788838 TCCCCCAATCCCCACTCCCTGGG - Intergenic
969131479 4:4993945-4993967 TCCCTGGACTCCCACACCCTTGG + Intergenic
977056390 4:92198334-92198356 TCCACCCACCCCCAAACCCTGGG + Intergenic
982206990 4:153004289-153004311 TCCTCCTCCCCACACACTCTGGG - Intergenic
984687046 4:182680655-182680677 TCCCACGACCCCCACACTGTGGG - Exonic
989436409 5:41418348-41418370 CACACAGACCCACACACCCTGGG + Intronic
989770241 5:45135979-45136001 CCCCCCGACCCCCCAACCCTGGG - Intergenic
991489309 5:67166782-67166804 CACCCCGACCCAAACACCATGGG + Exonic
992873070 5:81025436-81025458 TGCCCCAACACACACACCCTGGG - Intronic
998232110 5:140367412-140367434 TCCTCCAGCCCACACTCCCTGGG + Exonic
998252105 5:140560413-140560435 GGCCGCGACCCACACACCTTTGG - Exonic
998778803 5:145633206-145633228 TCTCCTGACCCACAGACACTTGG + Intronic
999219933 5:149966889-149966911 TCCCCAGACACACACAACTTTGG - Intronic
999242898 5:150137749-150137771 TCCCCCCACCCCCACCCCCAGGG + Intronic
1000185344 5:158852219-158852241 TCCCCCACCCCCCACACCTTGGG - Intronic
1002320327 5:178371636-178371658 TCACCCACCCCGCACACCCTGGG + Intronic
1003130184 6:3388898-3388920 TCCCCCTCCCCACAGCCCCTGGG - Intronic
1004193643 6:13486252-13486274 CCCCCCCACACACACACACTTGG + Intronic
1004422933 6:15487805-15487827 TTCTCCCACCCACCCACCCTGGG + Intronic
1005751278 6:28885222-28885244 GCCCCCGACCCTCCCACCCGTGG - Intergenic
1006051870 6:31351631-31351653 CCACCCCACCCACCCACCCTGGG + Intronic
1006085550 6:31592633-31592655 TCCTCCCACCCACACTCCTTGGG + Intronic
1006582830 6:35086652-35086674 GCCCCAGACCCACTCACACTGGG - Intronic
1006860951 6:37171055-37171077 TCACCCCACCCACTCATCCTGGG - Intronic
1013659679 6:112282308-112282330 TCCCCATACACACACACACTGGG + Intergenic
1016075339 6:139788822-139788844 TCCCCCTGCACACACACACTGGG + Intergenic
1018205099 6:161429689-161429711 ACCCTCCTCCCACACACCCTCGG - Intronic
1018676820 6:166229470-166229492 TCCCCCCACCCACACAGCATGGG - Intergenic
1018828223 6:167423489-167423511 TCCCCCCACACACACACACCCGG + Intergenic
1020104879 7:5418078-5418100 TCTCCCTGCCCCCACACCCTAGG - Intronic
1020683196 7:11261837-11261859 TCCCCCTACCCCCACAAGCTGGG - Intergenic
1024000657 7:45187346-45187368 CCACCTGACCCACACAGCCTGGG - Intergenic
1026549674 7:71357411-71357433 TCCCCATCCCCCCACACCCTTGG + Intronic
1027744594 7:82057431-82057453 TCCCCCAACACATACACACTTGG - Intronic
1028618163 7:92793846-92793868 TTCCCCAACCCCCACACCCCTGG - Intronic
1028924167 7:96339696-96339718 TCCCCTGGCCCACCCACCCCTGG + Intergenic
1029443840 7:100602323-100602345 TCCCCACGCCCACACACCCAAGG + Exonic
1030643711 7:112035095-112035117 TCTCCCTACCCTCACACCCTTGG + Intronic
1031524389 7:122807170-122807192 TGCCCCAACCCACAGACCCTTGG + Intronic
1033134322 7:138772447-138772469 TCCCCTGCCCCACTCACCCGTGG - Intronic
1033465558 7:141586198-141586220 TCTACACACCCACACACCCTGGG + Intronic
1034101894 7:148457603-148457625 TCCCCCTACCCCCACAGGCTCGG - Intergenic
1034272247 7:149808960-149808982 TCCTCCCACCCAGACACCCCTGG - Intergenic
1034412630 7:150949174-150949196 GCCCCCAACCCACACAACCGGGG + Intronic
1034702661 7:153109803-153109825 TCCACCGTCACACACAGCCTCGG - Intergenic
1036123056 8:6038611-6038633 TCCCTCCTCCCACACTCCCTGGG - Intergenic
1037969838 8:23164150-23164172 TGCACCCACCCACACAACCTGGG - Intergenic
1039493881 8:37966617-37966639 TCCCCCCACCCCAACTCCCTCGG + Exonic
1044727923 8:95208166-95208188 CCCCCACACACACACACCCTCGG - Intergenic
1044774169 8:95670277-95670299 TCCCTCGACCCAGTCACTCTTGG + Intergenic
1045028913 8:98116980-98117002 TCCCCGAACCCGCACGCCCTGGG + Intronic
1045769170 8:105714192-105714214 TCCCTCCCCACACACACCCTAGG - Intronic
1046312516 8:112457063-112457085 TCCCTCTACCCACAGAACCTTGG + Intronic
1048206732 8:132421529-132421551 TCCCCCGACCCACACACCCTAGG - Intronic
1048445296 8:134488727-134488749 TCCCCCGACCCTGACAACCCAGG - Intronic
1049255852 8:141613451-141613473 TCCCCTGACCCACAGGCCATGGG + Intergenic
1049270834 8:141695353-141695375 TCCCCCAACCCCCACCACCTGGG + Intergenic
1049533145 8:143166421-143166443 TCCTCCCAGCCCCACACCCTCGG - Intergenic
1049944226 9:579192-579214 TTCCCCGACCCACCCACCCTGGG + Intronic
1052872870 9:33524549-33524571 ACCCCCGACCCGCATACTCTTGG - Exonic
1054455221 9:65426976-65426998 TGCCCCGACCCACATGCCCGAGG + Intergenic
1054959138 9:70947735-70947757 TTCCCCCACCCACACACACCTGG - Intronic
1055757374 9:79571256-79571278 TCTCCCAACCCAGACACCTTCGG - Intergenic
1056795317 9:89655102-89655124 TCCCCTCACCGACAGACCCTAGG + Intergenic
1058025388 9:100137327-100137349 TCCCCAGACCCTAACACCCTTGG + Intronic
1058705951 9:107637967-107637989 TCCCCCGACCCACCCCCTCTGGG + Intergenic
1061076694 9:128345626-128345648 ACCACTGACCCACACAGCCTTGG - Intronic
1061660645 9:132127973-132127995 TCCCCCGCCCCACCCGGCCTCGG - Intergenic
1061910456 9:133719627-133719649 TCCCCCCACCCCCCCACCCCAGG + Intronic
1061950818 9:133934995-133935017 TCCCCAGCCCCACACCCCCTCGG + Intronic
1061995273 9:134180042-134180064 TCCCCTGACCCTCACACTCCAGG + Intergenic
1062527783 9:136985257-136985279 TCCCCCGACCCAGACAGGCTGGG - Exonic
1186526970 X:10257750-10257772 TCCCCCCACACACACACCAAAGG + Intergenic
1186549115 X:10483567-10483589 TGCCCCCAACCACACACCCAGGG + Intronic
1190712532 X:53081187-53081209 GCCCCCAAACCAAACACCCTGGG + Intergenic
1192242986 X:69349508-69349530 TCCCCTGACCCACAAAACCATGG + Intergenic
1192797889 X:74439681-74439703 TCCCCCACCACACATACCCTAGG - Intronic
1196379275 X:115070972-115070994 CCCGCCAACACACACACCCTAGG + Intergenic
1197703172 X:129615173-129615195 TCCCCCCGCACACACACCTTGGG - Intergenic
1197888229 X:131240063-131240085 TCCTCCCACACACACTCCCTAGG + Intergenic
1198082057 X:133249445-133249467 CCCCCCAACCCCCACCCCCTTGG + Intergenic
1198683476 X:139204939-139204961 TCCCTACACCCACACCCCCTCGG + Intronic
1199980785 X:152919309-152919331 TCCCCGGACCCACATTACCTAGG - Intronic