ID: 1048206742

View in Genome Browser
Species Human (GRCh38)
Location 8:132421564-132421586
Sequence ATTCACTTGGGGCAGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048206732_1048206742 12 Left 1048206732 8:132421529-132421551 CCTAGGGTGTGTGGGTCGGGGGA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG No data
1048206727_1048206742 17 Left 1048206727 8:132421524-132421546 CCTGACCTAGGGTGTGTGGGTCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048206742 Original CRISPR ATTCACTTGGGGCAGATGGT GGG Intronic
No off target data available for this crispr