ID: 1048209243

View in Genome Browser
Species Human (GRCh38)
Location 8:132441147-132441169
Sequence TTTGAGGTCTTCAAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048209243 Original CRISPR TTTGAGGTCTTCAAGTGTTG GGG (reversed) Intronic
900309394 1:2026095-2026117 TTTGGGGTCTTGAAATGTTTTGG - Intronic
901857105 1:12051666-12051688 TTAGAGGTATCCAGGTGTTGGGG - Intergenic
902394775 1:16126633-16126655 TTTGAGACCTTCAAGTGTGTGGG - Intronic
904781576 1:32953356-32953378 TTTGAGGTCTTTGAATATTGCGG - Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906144391 1:43551248-43551270 GTGGAGGGCTTCAAGTGTGGGGG + Intronic
906354868 1:45096170-45096192 TTATAGGTCTTCAAGTGATTAGG + Intronic
907466852 1:54643697-54643719 TTGTAGGTGTTCAAATGTTGGGG - Intronic
908766792 1:67561494-67561516 TATGAAGTCTTCAAGTCTTGAGG - Intergenic
910222273 1:84899406-84899428 TTTAAGGTGTTCAGGTGTTGGGG - Intergenic
912798754 1:112707640-112707662 TGAGAGGTCTTCAAGTTTGGGGG - Intronic
913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG + Intergenic
915895053 1:159805540-159805562 TTTCAGGTCTTCCATTGTTTGGG + Intronic
917388044 1:174499455-174499477 TTTGATGTTTACAAGTATTGAGG + Intronic
917507855 1:175644770-175644792 TTTCTGGTCTTGAAGTGCTGTGG + Intronic
920917327 1:210268330-210268352 TTTGAAGTCACCAAGTGTTGAGG - Intergenic
921911890 1:220558215-220558237 TCTGAGGTCTTCAGTTATTGGGG + Intronic
922247332 1:223813320-223813342 GTAGAGGGCTTCTAGTGTTGTGG - Intronic
924100671 1:240599718-240599740 TCCCAGGTTTTCAAGTGTTGTGG - Intronic
1064132856 10:12725417-12725439 TTTGATGTCCTTTAGTGTTGAGG - Intronic
1064456651 10:15493274-15493296 TTTGAGTTCTTCAAGAGTCTTGG - Intergenic
1066060789 10:31721904-31721926 TTTGAGGGGTTAAGGTGTTGTGG + Intergenic
1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG + Intergenic
1070011986 10:72484494-72484516 TCTGTAGTTTTCAAGTGTTGTGG - Intronic
1071712888 10:88067045-88067067 TTTGAGCGCTTCATGTGTAGCGG + Intergenic
1071937008 10:90543254-90543276 TTTGAGGTATTCTAGTGTAAAGG - Intergenic
1072080769 10:92028661-92028683 ATTGAGTACTTCAAGTGATGGGG - Intronic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1072442159 10:95466547-95466569 TTTGTGGTTTTTCAGTGTTGTGG - Intronic
1073562128 10:104505926-104505948 TTTGAACTCTTCAAATGGTGGGG + Intergenic
1074702834 10:116107433-116107455 TTTAAGGTCTTCATGTGTTCAGG + Intronic
1076367917 10:129934225-129934247 TCTGGGGTCTTCAAGGGTGGAGG - Intronic
1077793548 11:5467055-5467077 TTTGAGATTTTCAAATGCTGAGG + Intronic
1079002264 11:16767914-16767936 TTTTAGGCCATCAAGTTTTGAGG - Intergenic
1079479898 11:20868361-20868383 TTAGAGGTTTTCAAGTGCTGGGG + Intronic
1081585076 11:44378672-44378694 AATGAGGTCCTCAAGTGCTGGGG + Intergenic
1081873794 11:46395554-46395576 TTAGAGCTCTTGAAGAGTTGGGG + Intergenic
1082985247 11:59163362-59163384 TTTGATATCTTCAAGGGCTGTGG - Intergenic
1085177302 11:74501102-74501124 GTTGAAGTCTCCAACTGTTGTGG + Intronic
1088983034 11:114881062-114881084 TTTGTGGTTTTCTGGTGTTGGGG - Intergenic
1090001016 11:122958365-122958387 ATTGAGGTCTTCAAGGTCTGAGG - Intronic
1091385482 12:92031-92053 TATGAGGTTTTTATGTGTTGGGG - Intronic
1093240772 12:16669601-16669623 TTTGTGGTTTTCAAATGTTTTGG + Intergenic
1096596314 12:52697973-52697995 TCTGAGGTCTGGATGTGTTGAGG - Intronic
1097631964 12:62074987-62075009 TTCAAGATCTTCAAGTGTGGTGG - Intronic
1098486273 12:71025548-71025570 TCTGTGCTCTACAAGTGTTGTGG - Intergenic
1099356537 12:81643799-81643821 CTTGAGGTCTTCAAGTAGTAAGG + Intronic
1099819609 12:87693437-87693459 TTTGAGGACTTCCAGGGTTAGGG + Intergenic
1099983760 12:89638944-89638966 TTTAAACTCTTCAAGTATTGAGG - Intronic
1101887677 12:108680688-108680710 ATTGAGTACTTCAAGTGCTGGGG - Intronic
1101901626 12:108795072-108795094 TTTGAGGGCTTCAAATTTTAAGG - Intronic
1102737785 12:115178699-115178721 TTTAGGGTCTTCAACAGTTGAGG - Intergenic
1103302326 12:119937622-119937644 TTTGAGGTAGGAAAGTGTTGAGG + Intergenic
1106229309 13:27809555-27809577 CTTGAGATCTTCAGGTGTGGAGG + Intergenic
1107183738 13:37493081-37493103 TTTGAGTTCTCCCAGTGTTTGGG - Intergenic
1111473695 13:88719078-88719100 TTTGAGCCCTTCAACTTTTGAGG + Intergenic
1111526423 13:89476747-89476769 TTTGAGGTCTCCTACTGCTGGGG + Intergenic
1112277581 13:98035670-98035692 TTTGAAGTCTTGAAGTCATGGGG - Intergenic
1114409893 14:22490848-22490870 TTTGAGTACTGCAAGTGTTTGGG + Intergenic
1114782471 14:25553503-25553525 TTTGAGTTCCTCACGTGTTTTGG + Intergenic
1115827185 14:37291232-37291254 TTTTAGGTCTACAAATGTTTTGG + Intronic
1116562811 14:46402728-46402750 CTTTTGGTCTTCAAGTATTGGGG - Intergenic
1120260710 14:82181396-82181418 TTTGAGTTCTTCAAGGATTTTGG - Intergenic
1121622756 14:95361592-95361614 TTTGAGGTCGGCCAGTGTGGAGG + Intergenic
1121869966 14:97398400-97398422 TTTGATGTCACCAAGTGTAGTGG + Intergenic
1126444343 15:48725616-48725638 TTTGAGGTCTTTAAGTGGACAGG + Intronic
1130374475 15:83316194-83316216 TTTGTGGTTTTCAAGAGCTGGGG - Intergenic
1132924835 16:2423886-2423908 TTTGAGGGTTTGAAGTGTTGAGG - Intergenic
1134124697 16:11608455-11608477 TTTTAGGTTTTCAATTCTTGTGG - Intronic
1136923671 16:34351406-34351428 TTTGAGGTCTCCATGGGGTGAGG - Intergenic
1136980902 16:35060400-35060422 TTTGAGGTCTCCATGGGGTGAGG + Intergenic
1140699599 16:77569028-77569050 TTTGATGTTTTCAAGTGTTAAGG - Intergenic
1140961030 16:79913323-79913345 ATTGAGGTAATCAAGTGTTTGGG - Intergenic
1140982812 16:80126967-80126989 TTTGAGGTCTTTAATTATTTTGG + Intergenic
1142308175 16:89297270-89297292 TTTGACGTCTTCGAGTTTTACGG - Intronic
1146595567 17:34165492-34165514 TGTAAGGCCGTCAAGTGTTGTGG + Intronic
1147389672 17:40101386-40101408 TTTGAGGTCCTAAAGTAATGGGG + Intergenic
1148548290 17:48533178-48533200 TTTGAGCTCTTTCAGAGTTGGGG - Intergenic
1148860753 17:50603210-50603232 TTGGAGGTGTTCCAGTGCTGGGG - Intronic
1155328621 18:24691735-24691757 TTTGGGGTCTTTTAATGTTGGGG - Intergenic
1156977989 18:43248564-43248586 TTACAGTTCTTCAAGTGTTTGGG - Intergenic
1159731851 18:72036830-72036852 TTTGAGGTGTTCATTTATTGTGG + Intergenic
1160177046 18:76603456-76603478 TTTGAGGACTTCAAAGGTGGTGG + Intergenic
1162061047 19:8095535-8095557 TTTGATCCCTTCAAGTTTTGTGG - Intronic
925749148 2:7071869-7071891 TTTAAGGCCTTCAAGTGAAGTGG - Intergenic
927218918 2:20688534-20688556 TTGGAGGTGATCAAGTGCTGGGG + Intronic
927760037 2:25744354-25744376 TTTGATGTCTGCAAGAGTTCTGG + Exonic
928587413 2:32774762-32774784 TTTGAGGTCTTCAGAATTTGGGG - Intronic
929840495 2:45456687-45456709 TTTAAGGTCTTCTAAAGTTGAGG + Intronic
930146063 2:48005810-48005832 TTTGGGTTCTTCAAATTTTGGGG + Intergenic
935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG + Intronic
936006808 2:108896470-108896492 TTTGACGTCTTCCAGTGAAGTGG + Exonic
937102928 2:119285541-119285563 TTTGAGTTGGTCAGGTGTTGGGG - Intergenic
939894292 2:147773131-147773153 TTTGAGTTCTTCAAGAGGTATGG - Intergenic
940426269 2:153534988-153535010 GTTGAAGTGTTGAAGTGTTGGGG + Intergenic
940865185 2:158810729-158810751 ATTGAGGGCTTCAAGAGGTGGGG - Intronic
943725759 2:191249769-191249791 TTTGGGGTCTTCAAGTTCTGTGG + Intronic
944824897 2:203472828-203472850 TTTGATGACTTGAAGTCTTGAGG - Intronic
946073603 2:217055185-217055207 TTTGATGTCTTCAAGCACTGGGG - Intergenic
946916424 2:224527638-224527660 TTTGATGTCTTCTAATGATGAGG - Intronic
947199436 2:227601423-227601445 TTTGAGCTCTTCTAATGTTGCGG - Intergenic
948819953 2:240537504-240537526 TTTGAGGACTGCAAGGTTTGAGG - Intronic
948900415 2:240954007-240954029 TATAAGGTCTGCAAGGGTTGGGG - Intronic
1169616361 20:7450695-7450717 TTTGAGGGCTTCAAGACTAGTGG + Intergenic
1169619037 20:7483967-7483989 TTTGAGGGTTACAAATGTTGAGG - Intergenic
1175754656 20:61521883-61521905 TTGGAGGTCTGCAAGCATTGCGG + Intronic
1177126309 21:17197541-17197563 TTTGATGTCTTAAAGTTTTATGG - Intergenic
1179915236 21:44473157-44473179 TTTGAGGGCTTTAATTGATGGGG + Intergenic
1180427297 22:15209012-15209034 TTTGAGGGCTTCAAGTCCTATGG - Intergenic
1181788682 22:25246192-25246214 TTTTTGGTCATCACGTGTTGGGG - Intergenic
1181820371 22:25470893-25470915 TTTTTGGTCATCAAGTGTTGGGG - Intergenic
1184092440 22:42299666-42299688 TAGGAGGTCTTGAAGTGTTGGGG - Intronic
949187991 3:1217246-1217268 TTTGAGGTTCTCTAGTGCTGTGG + Intronic
949235375 3:1802516-1802538 TTTGAGATCTTTATATGTTGTGG + Intergenic
953175283 3:40545770-40545792 CTTGAGGTGCTTAAGTGTTGGGG + Intronic
954266868 3:49476543-49476565 TTTGAGGTTTTGCAGTGTTGAGG + Intronic
955407238 3:58633272-58633294 GTTGAGGGCTTCTGGTGTTGGGG - Intergenic
957789421 3:84919599-84919621 ATTGGTGTCTTCAAGTATTGTGG + Intergenic
957932220 3:86895374-86895396 TTTGGAGTTTTCAAGTGTTCAGG + Intergenic
959662406 3:108883493-108883515 TTAGTGGTCATCAGGTGTTGAGG + Intergenic
963246310 3:143066879-143066901 TTTGACTTCTTCTAATGTTGGGG + Intergenic
970591200 4:17561932-17561954 TTTGAGGTCTGCAAGTGACTGGG - Intergenic
971167813 4:24202574-24202596 TTTGATATATTCAAGTTTTGGGG - Intergenic
972447530 4:39159766-39159788 CTTATGGTCTTCTAGTGTTGTGG + Intergenic
972719484 4:41681796-41681818 TTTGTTGTCTTGAAGTTTTGGGG - Intronic
975349342 4:73328472-73328494 TTTGGGGCCTTTTAGTGTTGGGG + Intergenic
977573311 4:98652231-98652253 TATAAGGGCTTCAAGTGTGGGGG - Intronic
977887035 4:102263977-102263999 TTTGAGGTGTTCAAGACTTCAGG - Intronic
978150782 4:105431971-105431993 TTTGAGGTCATGAAATGTTTGGG + Intronic
982345055 4:154348312-154348334 GTTCAGGTCTTCAAGGGTTTTGG - Intronic
982751941 4:159172511-159172533 TCTGAGGGCTTTAAATGTTGGGG + Intronic
982764939 4:159335525-159335547 TGTAAGGTGTTAAAGTGTTGCGG + Intronic
985293287 4:188407751-188407773 TTTGAGGACATCTAGAGTTGAGG + Intergenic
985493579 5:192765-192787 TTTGAAGCCCCCAAGTGTTGGGG - Intronic
989995962 5:50831910-50831932 TTTGAGGGCTGAAAGTGTAGGGG + Intronic
990351749 5:54924308-54924330 TCTGAAGTCTTCAACTGTTATGG + Intergenic
992388818 5:76311964-76311986 TTTGAAGACTTCAAGAGATGAGG - Intronic
993960234 5:94288794-94288816 TTTGTGCTCGTCAAGAGTTGTGG + Intronic
997252043 5:132396682-132396704 TTAGAGCTCTTCATGTGGTGAGG + Intergenic
998997725 5:147884017-147884039 TTTGAAGTCATCAAGTAATGTGG - Intronic
999878337 5:155833503-155833525 TTTGATGTCTTCATCTGTTGGGG - Intergenic
1000818372 5:165952933-165952955 TTTGTGGTCTTAAATTATTGAGG + Intergenic
1001764614 5:174235579-174235601 TTTAAGTTCTTGAAGTGATGGGG - Intronic
1003798103 6:9629085-9629107 ATTGAGGTCTTGATGAGTTGAGG + Intronic
1005576820 6:27197685-27197707 TTTGAGGTCTGGAAGAGTGGAGG - Intergenic
1007952206 6:45882400-45882422 CTTGAGGTTTTCAAGGGTGGTGG - Intergenic
1009272578 6:61632927-61632949 TTTGAAGTATTCATGTTTTGAGG + Intergenic
1010228147 6:73511017-73511039 ATTGGTGTCTTCAAGTATTGTGG + Intergenic
1010495770 6:76532633-76532655 TCTGAGGACTTCATGTGCTGAGG + Intergenic
1011032111 6:82934633-82934655 TTAGATGTCTTCATGTGTTTTGG - Intronic
1011699125 6:89939455-89939477 TTTTAGGTCATTAAGTTTTGGGG + Intronic
1012633539 6:101505128-101505150 TTTGATATCTTAAATTGTTGAGG + Intronic
1013792479 6:113853406-113853428 TTAGAAGTCTGTAAGTGTTGTGG - Intergenic
1014224588 6:118833292-118833314 TTTGAGGTTTTGAAGTGTTAGGG + Intronic
1014589229 6:123242822-123242844 CTTGAGGCCTGCAAGAGTTGAGG - Intronic
1016754862 6:147673904-147673926 TTAGAGGTCTTCAGGTATTTGGG + Intronic
1016795325 6:148111125-148111147 ATTGAGGTCTTCAATTGTTTGGG - Intergenic
1017753390 6:157509705-157509727 TTTAAGGCCTTCAAGTTTTCTGG + Intronic
1019184059 6:170210668-170210690 TTTGAACTCTACCAGTGTTGAGG + Intergenic
1019528395 7:1491647-1491669 TTTGACCTCCTAAAGTGTTGGGG - Intronic
1019789112 7:2998944-2998966 TTTGAAGTCATTAAGTTTTGGGG + Intronic
1021274530 7:18633270-18633292 TCTGAGGCCTTCAAGTGTGGTGG + Intronic
1026010309 7:66630552-66630574 GTTGAGGGCCTCAATTGTTGAGG - Intronic
1029203598 7:98855296-98855318 TTCGAGGCATCCAAGTGTTGGGG - Exonic
1029442348 7:100594072-100594094 TTAGAGGTGGTCAAGTGTGGTGG - Intronic
1031866209 7:127040334-127040356 ATGGAGGTCTTCCAGTGTGGTGG - Intronic
1034077166 7:148243281-148243303 TTTGTGGTGTTCCACTGTTGGGG - Intronic
1034831896 7:154315847-154315869 CTTGAGGTCTTCAATACTTGGGG - Intronic
1036129847 8:6098877-6098899 TTTTAAGTCGTCAAGTTTTGAGG + Intergenic
1039198792 8:35063005-35063027 TTTGGGGGCTTCAAGTTTCGTGG - Intergenic
1039576666 8:38629132-38629154 TTTTAAGCCATCAAGTGTTGGGG + Intergenic
1043026248 8:75072939-75072961 ATTGAGGAGTTCAAGTGATGGGG - Intergenic
1044100081 8:88124210-88124232 TTTTAATTCTGCAAGTGTTGGGG - Intronic
1045484072 8:102616907-102616929 TTTTAAGTCATTAAGTGTTGGGG - Intergenic
1046053303 8:109049180-109049202 TGTGTGGTCTTCAATTGTTCAGG - Intergenic
1046813191 8:118554761-118554783 TTTGAGGCCTTCAACTGATTGGG - Intronic
1046824810 8:118676207-118676229 TTAGATGTCTTCAATTCTTGTGG - Intergenic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1050375042 9:4962483-4962505 TTTGAGGTGGTAAGGTGTTGGGG + Intergenic
1050658284 9:7853698-7853720 TTTGAGGTTTCTAAGTTTTGAGG + Intronic
1051138897 9:13955873-13955895 TTTGAGGTCTTCAGGTGTATAGG + Intergenic
1051656479 9:19386547-19386569 TATGAGTTTTTCAAGTGTTTTGG + Intergenic
1052497949 9:29252012-29252034 TTTGATTTCTTCAAATGTTGGGG - Intergenic
1053686260 9:40527525-40527547 TTTGAGGACTTCAAGTCCTATGG + Intergenic
1054875250 9:70089446-70089468 TTTGTGCTCTACAAGTTTTGGGG + Intronic
1055774544 9:79753302-79753324 TTTGAGCCCTTCAAGTCTTTAGG + Intergenic
1056537011 9:87537288-87537310 TATGAGGTTTTCATGTGTTTTGG + Intronic
1058655697 9:107218584-107218606 TTTGGTCTCTTCAAGTGATGGGG + Intergenic
1060429368 9:123536167-123536189 TTTGAGGTCTACTTGTGCTGAGG - Intronic
1061575946 9:131506243-131506265 TTTGAGGTCCTGAAGGGTAGGGG - Intronic
1190169496 X:48100684-48100706 TCCAAGGTCATCAAGTGTTGGGG + Intergenic
1194634636 X:96329757-96329779 TGTGAGGTCCCCAAGTTTTGTGG + Intergenic
1195806299 X:108771249-108771271 TTATAAGTCTTCATGTGTTGTGG - Intergenic
1197325754 X:125091439-125091461 TTTGAGGTGTCCAAATGTAGTGG - Intergenic
1197594541 X:128450253-128450275 TCTGAGGTCTCCAAGTATTTAGG + Intergenic