ID: 1048211660

View in Genome Browser
Species Human (GRCh38)
Location 8:132459144-132459166
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048211650_1048211660 16 Left 1048211650 8:132459105-132459127 CCTTGGTTGCAATTCATATGATT No data
Right 1048211660 8:132459144-132459166 ACGGGGGTTATGGGATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type