ID: 1048214083

View in Genome Browser
Species Human (GRCh38)
Location 8:132480304-132480326
Sequence GGAGGGCGGCGGCCGCGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048214083_1048214095 23 Left 1048214083 8:132480304-132480326 CCTCGTCGCGGCCGCCGCCCTCC 0: 1
1: 0
2: 8
3: 74
4: 512
Right 1048214095 8:132480350-132480372 GGCTCCGGCCCCGAGCGCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 167
1048214083_1048214091 2 Left 1048214083 8:132480304-132480326 CCTCGTCGCGGCCGCCGCCCTCC 0: 1
1: 0
2: 8
3: 74
4: 512
Right 1048214091 8:132480329-132480351 CAGCAGGGTCCCGTCTTTGTCGG 0: 1
1: 1
2: 0
3: 5
4: 86
1048214083_1048214092 8 Left 1048214083 8:132480304-132480326 CCTCGTCGCGGCCGCCGCCCTCC 0: 1
1: 0
2: 8
3: 74
4: 512
Right 1048214092 8:132480335-132480357 GGTCCCGTCTTTGTCGGCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048214083 Original CRISPR GGAGGGCGGCGGCCGCGACG AGG (reversed) Exonic
900113756 1:1020128-1020150 GGAGCGCGCGGGCCGCGCCGGGG - Exonic
900137880 1:1126114-1126136 GGAGGGCAGGGGCCGCGGGGTGG + Intergenic
900349559 1:2228186-2228208 GGCCGGCGGCGGGCGCGACGCGG + Intergenic
900349671 1:2228502-2228524 GGGCGGCGGCGGGCGCGGCGCGG + Intergenic
900643226 1:3697171-3697193 GGTGGGCCGCGGGTGCGACGTGG - Intronic
901001048 1:6149006-6149028 GGAGGAGGGCGGCTGCGAGGAGG - Exonic
901045371 1:6393000-6393022 CCAGGGCGGCGGCCGCGCCACGG - Intronic
901060183 1:6468248-6468270 GGGGTGCGGCGGCGGAGACGGGG + Exonic
901425935 1:9182494-9182516 GGCGGGCGGCGGCGGTGAAGGGG - Intergenic
902823236 1:18956230-18956252 CGGGGGCGGCGGCGGCGGCGGGG - Exonic
903190252 1:21652107-21652129 GGGGGGCGGCGGCCGGGAAGGGG - Intronic
903953996 1:27012556-27012578 GGCAGGCGGCGGCCCCGACCCGG - Exonic
904782918 1:32964343-32964365 GGAGGGCGGTGGCCCGGGCGCGG - Exonic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905416597 1:37808356-37808378 GGAGGGGGGCGGCCGAAAGGGGG + Exonic
905449163 1:38046227-38046249 GGGGGGCGGCGGCGGCGGCCTGG - Exonic
905672260 1:39799557-39799579 GGGGGGTGGCAGCGGCGACGGGG - Intergenic
905674700 1:39817251-39817273 GGGGGGTGGCAGCGGCGACGGGG + Intergenic
906204354 1:43979234-43979256 GGAGGGAGGCGGCGGCGCTGTGG + Intronic
906640509 1:47438222-47438244 GGTGGGCGGCGGCAGCGGCGGGG + Exonic
906640564 1:47438398-47438420 GGGGGGCGGCGGCCGCAGCGGGG + Exonic
906960960 1:50419264-50419286 GCAGGGCTGCGGCGGCGACGTGG - Exonic
907296562 1:53459717-53459739 GGAGGCTCGCGGCCGGGACGGGG - Exonic
907920022 1:58903697-58903719 GCCGGGCGGCGGGCGGGACGTGG - Intergenic
908534759 1:65067154-65067176 GGAGCGCGGGGGCGGCGGCGCGG - Intergenic
908714286 1:67053749-67053771 AGCGGGCGGCGGCGGCGGCGCGG - Intronic
910237149 1:85048097-85048119 GGTGGGCGGCGGCCTGGAGGGGG + Intronic
912515072 1:110211991-110212013 GGACGGAGGCGGCAGCGGCGCGG + Exonic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913186550 1:116374123-116374145 GGAGGGCGGCCGCCTCTGCGCGG - Exonic
913655375 1:120955004-120955026 GGAGGGTGGCTGCCGACACGCGG + Intergenic
914196019 1:145448502-145448524 GGAGGGCAGAGGCAGTGACGTGG + Intergenic
914645565 1:149649186-149649208 GGAGGGTGGCTGCCGACACGCGG + Intergenic
916663857 1:166947868-166947890 AGGGGGCGGCGGGCGCGACCGGG + Intronic
918015936 1:180632413-180632435 GGAGGCGGCCGGCCGCGGCGGGG - Intronic
918174328 1:182029897-182029919 GGATGGCGGCGGCCGGGTCCTGG - Intergenic
918423418 1:184386506-184386528 GGAGGGGAGCGGCCGCGCGGTGG + Intergenic
918550297 1:185734407-185734429 GGAGAGCAGCGGCGGCGGCGAGG + Intergenic
919463792 1:197908961-197908983 GGAGGGCTGCGGCGGGGACTAGG + Intergenic
920041483 1:203100464-203100486 GGAGGGCTGCGGCCACAACACGG + Intronic
920382741 1:205545048-205545070 GGTGGGCGGCGGCCGGGCAGAGG + Intergenic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
921029720 1:211326804-211326826 GGCCGGCGGCGGCGGCGAAGCGG - Intronic
922025165 1:221742818-221742840 GGAGGACGCAGGCCGCGTCGAGG - Intergenic
922730516 1:227946843-227946865 GGAGGGCGGCGGCCCGGCTGAGG + Intronic
922766402 1:228158690-228158712 GCAGGGCGGGGGCCGCGGCGCGG - Exonic
923665325 1:235993681-235993703 GGATCGCGACGGCCGCGAGGTGG - Exonic
924052425 1:240092265-240092287 AGGGGGCGGCGGCGGCGGCGGGG + Exonic
1062774517 10:134923-134945 GGCGGGAGGCGGCCGCGAGCCGG + Intronic
1063623027 10:7666754-7666776 GGAAGGGGGCGGCCGCGCCCGGG + Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064274193 10:13891765-13891787 CGGGGGCGGCGGCGGGGACGGGG - Intronic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1067300200 10:45001040-45001062 GGAGCGCGCTGGCCGCAACGAGG + Intronic
1069386068 10:67884584-67884606 AGAGGGCGGGGGCGGCGATGGGG + Intergenic
1070813596 10:79310513-79310535 GGAGGGCGGCTGCCTCAGCGTGG - Intronic
1071695329 10:87863714-87863736 AGACGGCGGCGGCCGCGGCCCGG + Exonic
1072591658 10:96832837-96832859 GGACGGCGGCGGCCACAGCGCGG - Intronic
1072745249 10:97934970-97934992 GGGGAGCGGCGGGCGCGGCGGGG + Intronic
1073122599 10:101131720-101131742 GGGGCTCCGCGGCCGCGACGGGG + Exonic
1073340919 10:102744007-102744029 GGAGGGAGGTGGCGGCGCCGTGG + Exonic
1074121734 10:110498352-110498374 GGAGGGCGGCGGCGGCGTCGCGG + Exonic
1075031968 10:119029832-119029854 GGGGGGGCGCGGCCGCGGCGGGG - Exonic
1075334490 10:121598458-121598480 CGGGGGCGGCGGCGGCGGCGCGG - Intronic
1075587156 10:123666311-123666333 GCCGGGCGGCGGCGGCGCCGAGG + Intergenic
1075627358 10:123972585-123972607 GGAGGGATGCGGCAGCGATGGGG + Intergenic
1075645145 10:124092249-124092271 GGATGGCAGCGGCCGGGGCGCGG - Intronic
1075871532 10:125774955-125774977 GGAGGTCAGCGGCCTCCACGCGG + Intronic
1077065546 11:639580-639602 TGAGGGCGGCGGGCGGGGCGCGG - Intronic
1077204690 11:1336749-1336771 GGAGGGCGGGGGGCGGGGCGTGG + Intergenic
1077253839 11:1572029-1572051 CGACGGCGGCGACGGCGACGCGG - Intergenic
1077576532 11:3387562-3387584 AGAGGGCGCCCGCCGCGATGCGG - Intergenic
1079128488 11:17734759-17734781 GGAGAGCGGCGGGCTGGACGCGG + Intergenic
1080418508 11:32091100-32091122 GGAGCGCGGCGGCAGCGACAGGG - Exonic
1080458436 11:32434932-32434954 GGAGTGAGGCGGCGGCGGCGGGG + Exonic
1081524183 11:43913342-43913364 GGAGGGTGGAGGACGGGACGGGG - Intronic
1081528504 11:43942834-43942856 CGAGGGCGGCCGCTGCGCCGGGG - Exonic
1083667884 11:64285385-64285407 GCAGGGCCGCGGGCGCGCCGGGG + Intronic
1085053652 11:73392213-73392235 TGGGGGCGGCGGGCCCGACGTGG + Exonic
1087634450 11:100687159-100687181 GGAGCGCGGCGGCGGGGAGGAGG + Intergenic
1089078879 11:115760159-115760181 GCAGGGCGGCGGCGGCGGCCGGG + Intergenic
1089242978 11:117097996-117098018 GGAGGGAGCCAGCCGCGGCGGGG - Intronic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1091243407 11:134069654-134069676 GGAGCGCGGCAGCTGCGGCGTGG + Intronic
1091550074 12:1530360-1530382 GGCGGGTGGCGGCCGCGGCTCGG - Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1095261661 12:40105622-40105644 CGCGGGCGGCGGCGGCGTCGGGG - Exonic
1096101014 12:48970494-48970516 CGAGGGCGGAGGCCGCGGCCGGG + Exonic
1096241301 12:49961686-49961708 GGGGGGCGGGGGTCGCGCCGGGG + Intergenic
1098369312 12:69739434-69739456 GGAGGGCCGCGGTCGCGAAGAGG + Exonic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1099202445 12:79691251-79691273 GGAGCGCGGCGGGCGCGCTGTGG - Intergenic
1100611532 12:96194908-96194930 CGACGGCGGTGGCAGCGACGCGG - Intronic
1100963070 12:99984734-99984756 CGGGGGCGGCGTCCGCGGCGGGG + Intergenic
1100963102 12:99984843-99984865 CGAGGGCGGCGGCGGCGGCGAGG + Intergenic
1100985635 12:100199765-100199787 GGAGGGCAGCGACGGCGATGGGG - Intronic
1102025774 12:109713775-109713797 GGCGGGCGGGGGACGAGACGCGG + Intergenic
1102854153 12:116278103-116278125 GTGGCGCGGCGGCCGCGATGTGG + Intergenic
1102913765 12:116737915-116737937 GGGGCGCGGCGGCCGGGGCGCGG + Exonic
1103309151 12:119990128-119990150 GGAGGGCGGCGGCTGCGGTCCGG - Exonic
1103424729 12:120823224-120823246 GGGGGGCGGCGGCGGTGGCGGGG + Intronic
1103623893 12:122204561-122204583 GCCGGGCGGCGGCGGCGGCGGGG - Exonic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1104732646 12:131116522-131116544 GGAGGGCTGCGGCCTGGAGGCGG + Intronic
1106308280 13:28532445-28532467 GGAGAGCAGCGGCCGCAGCGCGG + Intergenic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1106776807 13:33016778-33016800 GGCGGGCTGCAGCGGCGACGGGG - Exonic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1108518259 13:51222513-51222535 GGCGGGCGGCGGCGGCGAGGAGG + Exonic
1109075737 13:57832431-57832453 GGAGGGCTGCGGCAGCCAGGTGG + Intergenic
1110318201 13:74134287-74134309 CGAGGGCGGGGGCGGCGGCGGGG + Intergenic
1110436469 13:75482132-75482154 CGAGCGCGGCGGCCGCAGCGGGG - Intergenic
1110705919 13:78602140-78602162 GGGGGGCGGCGGCGGCGGCCCGG - Exonic
1110706212 13:78603436-78603458 GGCTGGCGGCGGCCCCGCCGCGG + Exonic
1113201067 13:107867600-107867622 GGCGGGCGGCGGCGGGGCCGCGG + Intergenic
1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG + Exonic
1114618540 14:24081481-24081503 GCGGGGCTGCGGGCGCGACGAGG - Exonic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115851793 14:37595162-37595184 GGCGGGCGGGGGCAGCGCCGGGG + Intronic
1117156994 14:52951191-52951213 GGAGGGCGGGGGCAGAGGCGAGG - Intronic
1118030314 14:61812502-61812524 GGAGGGGGACGGACGCGGCGAGG + Intergenic
1118137431 14:63045301-63045323 GGGGCGCGGCGGCGGCGACGGGG + Exonic
1119539245 14:75428047-75428069 GACGCTCGGCGGCCGCGACGGGG + Intronic
1119649915 14:76376254-76376276 GGGAGGAGGCGGCCGCGGCGGGG - Intronic
1119759402 14:77140641-77140663 GGCGGGAGGCGGGCGCGAAGGGG - Intronic
1119759659 14:77141547-77141569 GCAGTGCGGCGGCGGCGGCGCGG - Intronic
1121253124 14:92514022-92514044 GGAGTGGGGCGGCCAGGACGCGG - Intronic
1122267255 14:100552509-100552531 GGAGGGCGGCAGCCCCGGCAGGG - Intronic
1122300134 14:100726832-100726854 GGGGGGCGGGGGCCGCGAGGGGG + Exonic
1122558015 14:102592013-102592035 CGGGGGCGGGGGCCGCGGCGCGG - Intergenic
1122582084 14:102777397-102777419 GCGGGGCGGCGGGCGCGCCGGGG + Intergenic
1122649979 14:103220827-103220849 CGAGGGCGTCGGCCTCGGCGGGG + Intergenic
1122947721 14:105020824-105020846 GGAGGGCGGCGAGGGCGCCGCGG + Intronic
1123102373 14:105813433-105813455 GGAGGGTGGAGGCCGGGAGGAGG - Intergenic
1124088050 15:26570398-26570420 GGAGGGCGAGGCCCGCGAGGAGG - Intronic
1125541178 15:40471011-40471033 GGCGGGCGGCGGGCGCGGCGAGG - Exonic
1125603903 15:40929460-40929482 GCTGGGCGGCGACCGCGCCGAGG - Exonic
1126736620 15:51737536-51737558 CGAGCGCGGCGGCGGCGAGGGGG + Exonic
1126827740 15:52568753-52568775 GGAGGGCCGCGCCCGAGATGCGG - Intronic
1126852137 15:52804043-52804065 GGAGGGCAGCGGCCGCGTCACGG - Intergenic
1127417492 15:58771556-58771578 TGGGGGCGGCGGCCGCCAGGAGG + Exonic
1128115420 15:65102154-65102176 GGAGGGCCGCGGGGGCGACGCGG + Exonic
1128570478 15:68729955-68729977 GGGGGGCGGGGGCCGGGAGGTGG - Intergenic
1129752793 15:78077604-78077626 GGAGGGCGGCGGCGGCGGCGAGG - Exonic
1129752823 15:78077694-78077716 GGGGCGCAGCGGCCGCGGCGCGG - Intronic
1129846719 15:78771228-78771250 GGAGGCAGGTGGCCACGACGAGG - Exonic
1130224427 15:82046347-82046369 GGAGGGGCGCGGCCGGGAGGAGG - Intergenic
1130908692 15:88256820-88256842 GGGGGGAGGAGGCCGCGACGAGG - Intergenic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1132527588 16:425488-425510 GCAGTGCAGCGGCCGCGAAGGGG - Intergenic
1132683529 16:1153235-1153257 CGACGGCGGCGGCCTCGGCGCGG - Exonic
1132847835 16:2008899-2008921 GGCGGGGGGCGGCGGCGAGGAGG + Intronic
1132851565 16:2027134-2027156 GCAGCGCGGCGGCCTCGGCGGGG - Exonic
1132883790 16:2173596-2173618 GGAGGCCGGCGGCCCCGGCAGGG + Intronic
1132947266 16:2538338-2538360 GGCGGGCGGCGGCCTGGCCGGGG + Intronic
1133784386 16:8963448-8963470 GGCGGGCGGCGGCGGCGGCAGGG + Exonic
1135565788 16:23510200-23510222 GGAGGCCGGCGGCCGGGTAGGGG - Intronic
1136181265 16:28554166-28554188 GGAGGTCGGGAGCCGCGGCGCGG - Intronic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1137288908 16:47038173-47038195 GGAGGGCGGGAGCGGGGACGCGG + Intergenic
1137665345 16:50246222-50246244 GGAGCGCGGCGGGCGGGCCGGGG + Intronic
1138619099 16:58197769-58197791 AGAGGGTGGCGGCGGCGGCGCGG + Exonic
1138651387 16:58463483-58463505 GGCGAGCGGGGACCGCGACGCGG - Intronic
1139341481 16:66270571-66270593 GGAGGCCGGCGGCGGCCGCGTGG + Intergenic
1139484689 16:67248945-67248967 GGTAGGTGGCGGCGGCGACGCGG + Exonic
1140223109 16:73058189-73058211 GGCGGCCGGCGGCGGCGGCGCGG + Intronic
1141631682 16:85291443-85291465 GGAGGGCGGCGTCCCCTCCGAGG - Intergenic
1141665292 16:85462677-85462699 GGAGGGCGGCGGGGGCGCCGCGG + Intergenic
1141959059 16:87392481-87392503 CGAGGGCGGCGGGTGCGGCGGGG + Intronic
1142421454 16:89972861-89972883 GGAGGGCGGCGGCCCTGACCTGG + Intergenic
1142631441 17:1229008-1229030 GGGGGGCGGCGGCCGCAGCGGGG - Intronic
1142711162 17:1724807-1724829 GGAAGCCGGCGGCGGCGAAGAGG - Intronic
1142876382 17:2853889-2853911 GGAGGCCGGGGGCCGGGGCGCGG + Intronic
1143390523 17:6556694-6556716 GGAGCGCGGCGGCCACGGCCCGG - Intergenic
1143452477 17:7043847-7043869 GGCGGGCGGGGGCCCCGAAGGGG + Exonic
1143482952 17:7237989-7238011 GGCTGGCGGCGGCCCGGACGCGG - Intronic
1144840670 17:18183945-18183967 GGAGGGCTGCTGCGGAGACGCGG - Intronic
1145885736 17:28381341-28381363 GGCGGCCGGCGGCCTGGACGCGG + Exonic
1146022630 17:29292884-29292906 GGGGGGGGGCGGCCGCGGTGCGG + Intronic
1146167426 17:30600822-30600844 CGGGGGCGGCGGGCGGGACGGGG - Intergenic
1146339607 17:32007674-32007696 CGTGGGCGGCGGCGGCGGCGGGG - Intergenic
1147168552 17:38605568-38605590 CGGGGGCGGCGGCCGGGCCGGGG - Intronic
1147620663 17:41864780-41864802 GGAGGGCGGCGGGCGCGGAGAGG - Intronic
1147754767 17:42761126-42761148 GGACGGCGGCGGCCACGTGGGGG - Intronic
1147900282 17:43779057-43779079 GGAGCGCGGGCGCCGTGACGCGG + Intergenic
1147971002 17:44219131-44219153 GGAGGACGGCGGCCGGGAGGCGG + Intronic
1147994633 17:44354054-44354076 CGCGGGCGGCGGCGGCGGCGCGG + Exonic
1148035559 17:44656819-44656841 GGCGGGCGGGGGGCGCGGCGCGG + Intronic
1148048735 17:44759128-44759150 GGAGGGCGGGAGCAGGGACGGGG - Exonic
1148090253 17:45019076-45019098 GGAGGGCGGCGAGGGCGGCGAGG + Intergenic
1148547154 17:48527386-48527408 GGAAGGAGGTGGCCGCGAAGGGG - Intergenic
1148733440 17:49851399-49851421 GGCGGGTCGCGGCCGCGGCGAGG + Intergenic
1148786838 17:50149734-50149756 GGCGGGCGGCGGCGGCGGCGGGG + Exonic
1148796911 17:50201459-50201481 GGAGGGCGGTGGCCGCTAAGAGG + Exonic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149626351 17:58083346-58083368 GGACGGCGGCGCGCGCGGCGGGG + Intergenic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1151812443 17:76452667-76452689 GGGGGTCGGCGGCCGGGCCGAGG - Intronic
1152362538 17:79839347-79839369 GGCGAGCGGCGGCGGCGGCGGGG - Exonic
1152789728 17:82272857-82272879 GTAGGGCTGGGGCCGCGAAGCGG - Intronic
1152924480 17:83080848-83080870 CGGGGGCGGGGGCCGCGCCGAGG - Intronic
1153006188 18:500485-500507 GTAGGGCGGCGGCAGCTCCGCGG - Intronic
1153382605 18:4455389-4455411 GGCGGGCGGCGGCCGCGGCCCGG + Intergenic
1153855138 18:9137338-9137360 GGTGAGGGGCGCCCGCGACGAGG - Intronic
1157384189 18:47247929-47247951 TGAAGGCGGCGGCCGCGGCAGGG + Intronic
1158478782 18:57803065-57803087 GGCGGGCGGCGGCAGCGGCCAGG - Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1158976439 18:62715469-62715491 GGGGGGCGGTGGCGGCGAGGCGG + Exonic
1160499714 18:79395744-79395766 GGCGAGCGGCTGCCGCGGCGCGG + Intergenic
1160500728 18:79400206-79400228 GGAAGCCGGCGGCCGCGAGCCGG + Intronic
1160613945 18:80109687-80109709 GGCGGGCCGCGGGCGCGTCGGGG - Intronic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160776940 19:860899-860921 GGAGGGCTCCGGCTGCGACAGGG - Exonic
1160860444 19:1235237-1235259 GGAGGGCTGGGGCCGCGGCACGG + Intronic
1160860883 19:1236855-1236877 GGGGGGCGGCGGCCTCGGGGGGG + Intronic
1160864221 19:1250022-1250044 AAAGGGCGGCGGGCGCGACCGGG - Exonic
1160904286 19:1445279-1445301 GGAGGGCGGAGGCGGCTGCGCGG - Intergenic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160930621 19:1568095-1568117 CGCGGGCGGCGGCGGCGGCGCGG - Intergenic
1161060177 19:2210867-2210889 GGAGAGCGGGGGCCGTGGCGTGG - Intronic
1161108779 19:2456969-2456991 GGCGGGCGGCGGGCGCGGCGCGG - Exonic
1161397833 19:4054228-4054250 GCCGGGCGGGGGCCGCGGCGGGG - Exonic
1162046827 19:8005534-8005556 GGCGGGAGGCGGCGGCGGCGCGG + Exonic
1162481404 19:10928941-10928963 GGTGGGTGGCCGCCGCGACAGGG + Intronic
1162502148 19:11060110-11060132 GGCCGGCGGCGGCCGAGCCGAGG + Exonic
1162525370 19:11203448-11203470 GGAGGGGGGCGGGGGCGAAGAGG + Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162550457 19:11355551-11355573 AGGCGGCGGCGGCCTCGACGCGG + Exonic
1162832965 19:13298638-13298660 CGAGGGCGAGGGCCCCGACGGGG - Exonic
1163154494 19:15432540-15432562 TGGGGGCGGCGGCGGCGGCGCGG + Intronic
1163398089 19:17075763-17075785 GGGGAGCGGCGGGCGCGGCGGGG + Exonic
1163473475 19:17511648-17511670 CGAGGGCGGCGGCGGGGAGGAGG - Exonic
1163524401 19:17811831-17811853 GCAGGGCAGCGGCCGTGAAGCGG - Exonic
1163845755 19:19637400-19637422 GGCGGGCGGCGGGGGCGGCGGGG + Exonic
1164063853 19:21697190-21697212 GGAGGGAAGCGGCCCTGACGAGG - Intergenic
1164624115 19:29715252-29715274 GGAGGGCGGGGCCAGCGCCGGGG - Intronic
1164639018 19:29811684-29811706 GCGGGGCGGCGGGCGGGACGCGG - Intergenic
1164755442 19:30685749-30685771 GGAGGACGGCGGCAGCGGCTGGG - Intronic
1164835111 19:31350873-31350895 GGAATGGGGCGGCCGCGCCGGGG + Intergenic
1165157409 19:33796718-33796740 CGGAGGCGGCGGCCGCGAAGAGG + Intronic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165837717 19:38769904-38769926 TGACGGCGGCGGCCGCCAGGGGG + Intronic
1165850857 19:38849699-38849721 GGCGGGCGGCGGCGGCGGTGGGG - Exonic
1166083252 19:40458274-40458296 GGTGGGCGGCGGCGGCGGCAGGG + Intronic
1166121737 19:40690804-40690826 GCGGGGCGGTGGCCGCGCCGGGG - Intronic
1166126321 19:40717226-40717248 GGAGGGCGGCGGCGGCAGCCGGG + Exonic
1166734240 19:45075322-45075344 GGAGGGCAGCGGCCGGGGGGAGG - Intronic
1166765674 19:45251328-45251350 GGCGGGCGGGGGCCGCGGAGGGG - Exonic
1166888258 19:45973958-45973980 CGCGGGCGGCGGCGGCGACGGGG + Intergenic
1166984175 19:46649665-46649687 GGAGGGCGGCCGCAGGGCCGCGG + Exonic
1167258074 19:48442922-48442944 GGAGGGCGGCGGCTTCTGCGGGG - Exonic
1167369654 19:49072834-49072856 CGCGGGCGGCGGCGGCGGCGGGG - Exonic
1167638635 19:50668531-50668553 GGCGGGCGGCGGCTGCGGGGAGG + Exonic
1167797549 19:51719650-51719672 GGCGGGTGGCGGCGGCGGCGCGG - Exonic
1167995120 19:53395637-53395659 GGAGGGAGGCGGCGGCGCCACGG - Intronic
1168026554 19:53647820-53647842 AGAGGGAGGAGGCCGCGGCGGGG - Intergenic
1168536072 19:57172012-57172034 GGGGGGCGGGGGCCGCGAGGGGG + Intergenic
1168604409 19:57747057-57747079 GGATGGCGGCGGCCGCGCTGAGG + Exonic
1168628170 19:57935173-57935195 GGATGGCGGCGGCCGCGCTGAGG - Exonic
925191932 2:1892111-1892133 GGATGGCGGTGGCCGCCATGTGG + Exonic
927216614 2:20671034-20671056 GGACGGCGTTGGCCGGGACGCGG + Exonic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927652247 2:24919901-24919923 GGAAGGAGGAGGCGGCGACGAGG + Intergenic
927938035 2:27086331-27086353 GGTGGGCGGCGCCCGCGCGGGGG - Exonic
928904431 2:36355621-36355643 GGAGGGGGCCGGCCGGGCCGGGG + Intergenic
929188563 2:39120294-39120316 GGGGGGCTGCGGCCGGGAAGCGG + Intronic
931253540 2:60552563-60552585 GGAGAGGGGCCGCGGCGACGGGG - Intronic
931348828 2:61470816-61470838 GGCGGGCGGCGGCGGGGACGGGG + Intergenic
932231498 2:70087557-70087579 GGCGGGCGGCGGCGGCGGAGGGG - Exonic
932625213 2:73291871-73291893 GGTGGGCGGCGGCGGCGGCACGG + Exonic
933655258 2:84881273-84881295 GGTGGGCGGCGGCCCCGGCAGGG - Intronic
933666739 2:84970944-84970966 CGCGGCCGGCGGTCGCGACGGGG - Intergenic
933875996 2:86622943-86622965 CGAGGGCGGGGGCCGCGGCTCGG + Exonic
933911118 2:86942346-86942368 GCCGGGCGGCGGCCTCGACCTGG + Intronic
933911126 2:86942368-86942390 GCCGGGCGGCGGCCTCGACCTGG + Intronic
933911179 2:86942542-86942564 CGGCGGCGGCGGCCTCGACGTGG + Intronic
933911219 2:86942685-86942707 GGGCGGCGGTGGCCTCGACGTGG + Intronic
934011616 2:87825554-87825576 GCCGGGCGGCGGCCTCGACCTGG - Intronic
934011624 2:87825576-87825598 GCCGGGCGGCGGCCTCGACCTGG - Intronic
934011632 2:87825598-87825620 GCCGGGCGGCGGCCTCGACCTGG - Intronic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
935112282 2:100104718-100104740 GGCGGGGGGCGGCGGCGGCGCGG - Intronic
935775571 2:106468157-106468179 GCCGGGCGGCGGCCTCGACCCGG - Intronic
935904512 2:107827896-107827918 GGGCGGCGGCGGCCTCGACCTGG + Intronic
935904564 2:107828101-107828123 GGGCGGCGGCGGCCTCGACCTGG + Intronic
935904594 2:107828216-107828238 GGGCGGCGGCGGCCTCGACCTGG + Intronic
935904693 2:107828601-107828623 GGGCGGCGGCGGCCTCGACCTGG + Intronic
935904723 2:107828716-107828738 GGGCGGCGGCGGCCTCGACCTGG + Intronic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936427440 2:112433319-112433341 GGGCGGCGGCGGCCTCGACCCGG - Intronic
936427450 2:112433344-112433366 AGAGAGCGGCGGCCTCGACCCGG - Intronic
936556915 2:113503925-113503947 GGGGCGCGGGGGCCGGGACGCGG + Intergenic
938414533 2:131093353-131093375 GGAGCGCGGCGTCCGGGAGGCGG - Exonic
938796106 2:134719155-134719177 GGAGCGCGGCGGCAACAACGCGG - Intergenic
941906164 2:170717050-170717072 GGCGGGCGGCGCCCCCGAGGCGG + Exonic
941979086 2:171434731-171434753 GGAGGGCCGCGGGCGCGCGGCGG + Exonic
942046515 2:172102298-172102320 GGCGGGCGGCGGCGGCGGCGGGG - Exonic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942453668 2:176123412-176123434 AGAAGGCGGCAGCGGCGACGGGG + Exonic
944515732 2:200510027-200510049 GGCGTCCGGCGGCCGCGCCGAGG - Exonic
945251625 2:207769702-207769724 GGCGAGCGGCGGGCGGGACGCGG - Intergenic
945492837 2:210476469-210476491 CGAGGGCGGCGGCGGCGCCCAGG + Exonic
946701963 2:222423898-222423920 GAAGGGCAGGGGCAGCGACGCGG + Intergenic
946921522 2:224585492-224585514 GGAGCCCGGCGGCCGCCGCGGGG + Intergenic
947188027 2:227472318-227472340 GGAGGGCGGCGGCCGCGGCCAGG + Exonic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948824681 2:240568504-240568526 GCCGGGCGGCGGCGGCGGCGGGG - Intronic
949014587 2:241702203-241702225 GGAGGGCGGCGGGCGCGGCCGGG + Intronic
1168795884 20:610042-610064 GGCGGGCGGCGGCGGCGGCGCGG - Exonic
1168965302 20:1894887-1894909 GGAGGGCGGGGGCAGCGGCCGGG + Intronic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169278454 20:4248789-4248811 CGCGGGCGGCGGCGGCGGCGTGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1170578600 20:17681897-17681919 GGCGGGCGGCGGGCGGGCCGGGG + Intronic
1172061550 20:32190216-32190238 GCCGGGCGGCGGGCGCGCCGCGG + Intergenic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1173251526 20:41366436-41366458 GGCGGGCGGCGGGCGGGAAGAGG - Intronic
1174386664 20:50191524-50191546 GGCGGGCGGCGGCGGCGGCGGGG - Exonic
1175036074 20:56003343-56003365 GGAGGGCGGGGGCAGAGCCGGGG - Intronic
1175439652 20:58981556-58981578 GGACCCCGGCGGCCGCGCCGCGG - Intronic
1176127897 20:63484142-63484164 GGAGGGCGGTGGCCGGGGTGAGG - Intergenic
1176238061 20:64063433-64063455 GGGGGTCGGCGGGCTCGACGGGG - Intronic
1176549734 21:8216030-8216052 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176550022 21:8217024-8217046 GGCCGGCGGCGGCCGCCGCGGGG + Intergenic
1176557625 21:8260259-8260281 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176568659 21:8399064-8399086 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1179674902 21:42974734-42974756 GGCGGGCGGCGGCCGCGGGCCGG - Intronic
1180051477 21:45333463-45333485 GTAGGGTGGCGGCGGGGACGAGG + Intergenic
1180167983 21:46040022-46040044 GGAGGGTGGAGGGCGGGACGTGG - Intergenic
1180733807 22:18001187-18001209 GGAAGGAGGCGCCCGCGCCGCGG + Intronic
1180891426 22:19291747-19291769 GGAGGGCGGGGGCCAGGACCGGG - Intergenic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180960668 22:19760998-19761020 GTAGCGCGGCGGCGGCGGCGGGG - Exonic
1181057846 22:20268296-20268318 CGAGGGCGGCGGCGGCGCGGGGG + Exonic
1181477988 22:23180466-23180488 GGGGGGAGGTGGCCGCGGCGCGG - Exonic
1181532117 22:23522722-23522744 GGAGGGCGGGGGCCGGGCTGGGG + Intergenic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1183201354 22:36387584-36387606 GGAGGGCGCCGGCAGCAGCGAGG - Intronic
1183642520 22:39101152-39101174 TGGGGGCGGGGGCCGGGACGGGG - Intronic
1183739479 22:39662090-39662112 GGAGCGCGGCGGCGGCGCCCGGG + Exonic
1184362040 22:44024522-44024544 GGAGGGCGGGGGCGGCCTCGTGG - Intronic
1184412080 22:44331451-44331473 GCAGGGCGGGGGCCGCGCGGGGG - Intergenic
1184508088 22:44916426-44916448 CGAGGGCGGCGGGCTCGGCGAGG + Exonic
1184759591 22:46537107-46537129 GCAGGGCGGCGGCGGCGGCCAGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185182014 22:49369096-49369118 AGTGGGCAGCGGACGCGACGAGG - Intergenic
1185302535 22:50090012-50090034 GGCGGGCGGCGGGAGCGGCGCGG + Exonic
1185314000 22:50170958-50170980 TGAGGCCGGCGGCCGGGGCGCGG + Intronic
1185397547 22:50600650-50600672 GGAGGGCGGCGGGGGAGGCGGGG - Intronic
1185409350 22:50674210-50674232 GGAGGGCGGGGGCCGAGCCACGG - Intergenic
1203254912 22_KI270733v1_random:133350-133372 GGCCGGCGGCGGCCGCCGCGGGG + Intergenic
1203262968 22_KI270733v1_random:178429-178451 GGCCGGCGGCGGCCGCCGCGGGG + Intergenic
950153844 3:10708046-10708068 GGCGGGCGGCGGCGGGGCCGCGG - Intergenic
951217669 3:20040326-20040348 GGAGGGCGGGGGCGGGGAGGGGG + Exonic
952816487 3:37452081-37452103 GGAGGGGCGCGCCCGCGAGGTGG - Intergenic
953246722 3:41199844-41199866 GGAGGGCGGCGGCCGGGCCCGGG + Intronic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954093090 3:48301119-48301141 GGAGGGCGGCGGCCCAGCCCTGG + Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955195517 3:56801889-56801911 GCCGGGCGGCGGCGGCGACACGG + Intronic
956678186 3:71754288-71754310 GGCGTGCGGCGGCCGCGGCGGGG + Exonic
956678239 3:71754529-71754551 GGACGGCGGTGGCGACGACGAGG + Exonic
958814488 3:98901251-98901273 CGGGGGCGGCGGCCGCGGCCCGG + Exonic
960628319 3:119702962-119702984 GGAGGGAGGAGGCCGCGGGGCGG - Intergenic
961446289 3:126983215-126983237 GGCGGACGGCGGCGGCGGCGCGG + Intergenic
961735932 3:129002163-129002185 GGCGGGCGGCGGCGGCGGCGCGG - Exonic
961827627 3:129606985-129607007 CGACGGCGGCGGCGGCTACGGGG - Intergenic
962318779 3:134374608-134374630 GGAAGGCGGGGGCCGGGAGGAGG - Intronic
962575514 3:136752127-136752149 GGAATGCGGCGGCAGCGGCGCGG - Intronic
962793898 3:138834671-138834693 TGAGTGCGGCGGCCGGGACCCGG - Intronic
963133115 3:141876537-141876559 GGCGGGAGGCGGCAGCGGCGCGG + Intronic
963835155 3:150050724-150050746 AGATGGCGGCGGCGGCGGCGGGG + Intronic
965684205 3:171284116-171284138 GGAGGGGGGCGGCAGGGAGGAGG + Intronic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966934657 3:184698017-184698039 GGAGGGCGGAGGCAACGACGAGG - Intergenic
968148250 3:196317900-196317922 GGAGGCGGGAGGCCGCGAGGCGG - Intronic
968457179 4:705790-705812 CGAGCGCGGCGCCCCCGACGCGG + Exonic
968729268 4:2262007-2262029 GGACGGCGGCGGCCGCTGCCCGG + Exonic
968756354 4:2418232-2418254 GGAAGGGAGAGGCCGCGACGCGG + Intronic
968815185 4:2818265-2818287 GGAGGCGGGCGCCCGGGACGAGG + Exonic
969508388 4:7602554-7602576 GGATGGCGGCGGCCGGGAAGAGG + Intronic
969600140 4:8171362-8171384 GGAGGGAGGCGGCCCATACGGGG - Intergenic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970333162 4:15004281-15004303 GGAAGGCGGCGGCCGCCGCCTGG - Exonic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
972321654 4:37977647-37977669 GGCGAGCGGCGGGCGCGACCAGG + Intronic
972396764 4:38664495-38664517 GGAGGGGGGCGGCAGGGACCAGG - Intronic
972686905 4:41360741-41360763 GGAGGCCGGCGGGCGGGAAGGGG + Intronic
972765862 4:42151958-42151980 GAAGGGCGGCGGGGGCGGCGGGG + Exonic
975622051 4:76306162-76306184 GGAGGACGGCGGGCGCGGTGCGG - Intronic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
981044587 4:140253258-140253280 GGAAGGCGGCGGCGGCGGCAGGG + Intergenic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
984952381 4:185017169-185017191 GGAGGGGGGCGGCGGCGGCTGGG - Intergenic
985064229 4:186105267-186105289 GGCGGGCGACCGCCGCGAGGCGG - Intronic
986330696 5:6714192-6714214 GCCGGGCGGCGGGGGCGACGCGG - Intergenic
987050402 5:14143562-14143584 GGGGGGCGGCGGCGGCGGCTCGG - Intergenic
987108706 5:14664893-14664915 GGGAGGCGGCGGCCACGGCGCGG + Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994043349 5:95283755-95283777 GGGGGGCGGGGGCCGGGAGGCGG - Intronic
996978486 5:129461441-129461463 GGGAGGCGGCGGCTGCCACGAGG - Exonic
998583558 5:143403957-143403979 GGGTGGCGGCGGCAGCGGCGGGG + Intronic
998957624 5:147453703-147453725 GGCGGGCGGAGGCGGCGGCGCGG - Intronic
999300253 5:150486272-150486294 GGCGGGAGGCGGCCGCGAAGGGG + Intronic
1001159571 5:169301068-169301090 GGAGCGCGGCGGCTGCGGCTGGG + Intronic
1001639134 5:173232899-173232921 GGCAGGCGGCGGCGGCGGCGGGG + Exonic
1001688743 5:173616412-173616434 GGCGGACGGCGGCGGCGGCGGGG - Exonic
1002646509 5:180659177-180659199 GGGGGGTGGCGGCGGGGACGCGG - Intergenic
1002646522 5:180659203-180659225 GGGGGGTGGCGGCGGGGACGCGG - Intergenic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1003552117 6:7108810-7108832 GGACGGCGCCGGCCGGGAGGGGG + Intronic
1004044700 6:12012484-12012506 TGATGGCGGCGGCCGCGGCTCGG - Exonic
1004262079 6:14117573-14117595 CGAGGGCGGCGGGTGCGACGGGG + Intronic
1004864177 6:19837433-19837455 GGAGCGCGGCGGCCGCGATCGGG + Exonic
1005278929 6:24250088-24250110 GGAGGGAGGCTGCCGGGACCCGG - Intronic
1005915235 6:30345414-30345436 GGCGGGCGGCGGGCGGGACGCGG + Intronic
1005959733 6:30686610-30686632 GGAGGGCGGCGGCAGCAGCCGGG + Exonic
1006396073 6:33788592-33788614 GGAGGAAGGCAGCCGCGCCGGGG + Exonic
1006787744 6:36679535-36679557 GGAGGACGGAGACCGCGAAGGGG - Intronic
1007558066 6:42782996-42783018 GGAGGGAGGCGGCGGAGACGGGG + Intronic
1008160394 6:48068875-48068897 GGCGGGCGGCGGGCGCCGCGGGG + Intergenic
1009437591 6:63635917-63635939 GGGCGGCGGCGGCTGCAACGAGG + Exonic
1010044086 6:71420482-71420504 GGTGGGCGGCGGCGGCGAAAGGG - Intergenic
1010703304 6:79077778-79077800 GGAGGGAGGCGGCGGCGGCGGGG - Intronic
1011607424 6:89118236-89118258 GGAGGGCGGAGGCCAAGAGGGGG + Intergenic
1012400018 6:98835107-98835129 GGGGGGCGGGGGCGGCGGCGGGG + Exonic
1012401400 6:98845210-98845232 GGGAGGCAGCGGCCGCGACCTGG - Intergenic
1013048825 6:106512407-106512429 GGAGCTCGGCGTCCGCGCCGGGG - Exonic
1013117563 6:107114734-107114756 GGCGGGCGGCGGCGGCGGCGCGG + Intronic
1013369314 6:109455782-109455804 GGAGGGCGGGGGCGGGGGCGGGG + Exonic
1013575915 6:111483340-111483362 GGAGGGCGGGGGCCGAGAAGGGG + Intronic
1014230100 6:118893973-118893995 GGAGGCCGCCGGCGGCGGCGCGG - Intronic
1014632506 6:123803792-123803814 GTCGGGCGGCGGCCGCGCTGGGG + Intergenic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015799193 6:137044197-137044219 GGGGCCCGGCGGCCGAGACGCGG + Intronic
1016330077 6:142945867-142945889 GGCGGGAGGAGGGCGCGACGCGG + Intergenic
1016433169 6:144008492-144008514 GGGGGTCGGCGGCCGAGGCGGGG + Intronic
1016454560 6:144216821-144216843 GGCGGGAGGCGGCCGGGAGGGGG + Intergenic
1019111796 6:169723626-169723648 GGCGGGCGGGGGACGCGGCGCGG - Intronic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019486068 7:1289756-1289778 CGAGGGGGGCGGCGGGGACGGGG + Intergenic
1019537834 7:1538250-1538272 GGACGGCGGGGGCGGCGGCGGGG + Intronic
1019562506 7:1665673-1665695 AGGGGGCGGGGGCCGCGGCGGGG - Intergenic
1019984037 7:4642136-4642158 GGAGGGGAGCTGCCGCGCCGGGG - Intergenic
1020204744 7:6105459-6105481 GGGGGGCGGCGGGCGGGCCGGGG - Intronic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1020278310 7:6637517-6637539 CGGGGGCGGCGGCGGCGGCGGGG + Intronic
1020383087 7:7567110-7567132 GGAGCGCCGCGGCCGCAGCGAGG + Intronic
1020418222 7:7969476-7969498 TGCGGGCGGCGGCGGCGGCGTGG + Exonic
1021231114 7:18086968-18086990 CGAGAGCGGCGGGCGCGGCGCGG - Intronic
1022106383 7:27200297-27200319 GGACGGCGCGGGCCGCGGCGGGG - Intergenic
1022207970 7:28180818-28180840 GGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1023177538 7:37448463-37448485 TGAGGGCTGCGGGCGCGTCGGGG - Intronic
1023791777 7:43758622-43758644 GGGGGGCGGGGGCCCCGAAGCGG - Intergenic
1023849995 7:44145186-44145208 GGAGGGCAGTGGCCGGGGCGCGG - Exonic
1023951278 7:44848025-44848047 CGAGAGCGGCGGCGGCGGCGCGG - Exonic
1023955722 7:44885360-44885382 GGCGGGCGGTGGCGGCGAGGCGG - Exonic
1024085427 7:45888522-45888544 GGAGGGTGGCGGCGGCGCGGCGG - Exonic
1024262378 7:47582076-47582098 GCAGGGCGATGGCCGCAACGAGG + Exonic
1024724775 7:52180144-52180166 GGAGGGCGGCGGCTGCACCCAGG + Intergenic
1028417475 7:90595960-90595982 GGAGGGGCGCGGCCGGGAGGGGG + Intronic
1028988335 7:97024762-97024784 AGGAGGCGGCGGCCGCGGCGAGG + Exonic
1029123246 7:98281899-98281921 GTAGGGCGGCGGCGGGGGCGCGG - Exonic
1030033565 7:105389217-105389239 GGAGGGGAGAGGCCGCGGCGGGG - Intronic
1030138702 7:106284567-106284589 GGCGCGCGGCGGCGGCGGCGCGG - Intronic
1033099722 7:138460180-138460202 GGAGGGCGGGGGCGGGGGCGGGG + Intergenic
1033390531 7:140924195-140924217 GGGCGGCGGCGGCCTCGACGTGG - Intronic
1033589423 7:142797332-142797354 GGAAGGCGGCGGCTGCTTCGCGG + Intergenic
1034670542 7:152854351-152854373 GGAGGGTGGAGGCCGGGATGAGG + Intronic
1034702441 7:153108322-153108344 GGAGGGCTGGGGCAGCCACGTGG - Intergenic
1034977674 7:155457781-155457803 GCGGGGCGGCGGCCGCGAGGAGG + Intergenic
1035160981 7:156949813-156949835 GGCGGGCGCGGGCCGCGCCGCGG + Exonic
1035168598 7:157005765-157005787 GAAGGGCGGCGGCGGGGGCGCGG - Exonic
1035203321 7:157279899-157279921 GGACGGCGGCGGCCGCTCCCAGG - Intergenic
1036723769 8:11201249-11201271 GGTGGGCAGCGGCGGCGAGGAGG - Exonic
1038807979 8:30812451-30812473 GGAGGGCGGCGGCCGGGCTGGGG - Exonic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1040109413 8:43560348-43560370 GGAGGGAAGCGGCCCTGACGGGG - Intergenic
1041919833 8:63168978-63169000 GGCCGGCAGCGGCGGCGACGGGG - Intronic
1043401742 8:79891529-79891551 GGAAAGCGGCGGCCGCGCGGGGG - Intergenic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1045432209 8:102124374-102124396 GGGGGTCTGCGGCCGCGAGGAGG - Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1047277380 8:123416508-123416530 GGTGGGCGGAGCCCGGGACGAGG - Intergenic
1048214083 8:132480304-132480326 GGAGGGCGGCGGCCGCGACGAGG - Exonic
1048214132 8:132480478-132480500 GGCTGGCGGCGGCGGCGACGGGG - Exonic
1048554005 8:135457703-135457725 GGAAGGCGGCGGCGGCGGCACGG - Exonic
1049145863 8:141000916-141000938 GGAGGCCGGTGGCCGTGAGGAGG - Intronic
1049235048 8:141508165-141508187 GGAGGGCCGCGGCCTGGACGGGG + Intergenic
1049411432 8:142475571-142475593 GGAGGGCGGCGGCTGCGAGGGGG + Exonic
1049620905 8:143597937-143597959 AGGGGACGGCGGCCGCGGCGCGG - Exonic
1049620933 8:143597995-143598017 GGGGGGCGGCGGCCGTGCAGCGG - Exonic
1049651559 8:143772072-143772094 CGAGGGCGTGGGCCACGACGAGG + Intergenic
1049896085 9:113376-113398 GGGGCGCGGGGGCCGGGACGCGG - Intergenic
1049957512 9:707226-707248 GGAGCGCGGCGGGCGCCACGTGG + Intronic
1050744160 9:8857792-8857814 GCTGGGCGGCGGCGGCGACCAGG - Intronic
1050874026 9:10613110-10613132 GGCGGGCGGGGGCCGGGGCGGGG + Intergenic
1051278905 9:15422420-15422442 GGAGGGCGAGGGCCGAGACCAGG - Intergenic
1051876758 9:21802169-21802191 GCGGGGCGGCCGCCGCGGCGGGG - Intergenic
1053690454 9:40584295-40584317 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690460 9:40584313-40584335 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1053690466 9:40584331-40584353 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1053690474 9:40584357-40584379 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690482 9:40584383-40584405 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690491 9:40584412-40584434 GGCGGGCGGCGGCGGCGGCGCGG - Intergenic
1053690499 9:40584438-40584460 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690507 9:40584464-40584486 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054274323 9:63053084-63053106 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054274338 9:63053136-63053158 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054274344 9:63053154-63053176 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054301702 9:63385238-63385260 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054301708 9:63385256-63385278 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054301716 9:63385282-63385304 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301724 9:63385308-63385330 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301732 9:63385334-63385356 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301740 9:63385360-63385382 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301748 9:63385386-63385408 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301756 9:63385412-63385434 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400479 9:64711774-64711796 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400485 9:64711792-64711814 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054400491 9:64711810-64711832 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054400499 9:64711836-64711858 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400507 9:64711862-64711884 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434065 9:65196018-65196040 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434071 9:65196036-65196058 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434077 9:65196054-65196076 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434083 9:65196072-65196094 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054434089 9:65196090-65196112 GGCGGGCGGCGGCGGCGAGGCGG - Intergenic
1054434098 9:65196119-65196141 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434107 9:65196148-65196170 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054496293 9:65825566-65825588 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054496302 9:65825595-65825617 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496308 9:65825613-65825635 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496314 9:65825631-65825653 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1054496320 9:65825649-65825671 GGCGGGCGGCGGCGGCGAGGCGG + Intergenic
1055308200 9:74952236-74952258 GGGGGGCGGTGGCGACGACGGGG - Exonic
1055514734 9:77023237-77023259 GGAGGGCGGAGGCCGGGACGCGG - Intergenic
1056643212 9:88388408-88388430 GGCGGGCGGCGTCCGCGGCGAGG + Exonic
1056773923 9:89498002-89498024 GGCGGGAGGCGGCCGGGCCGGGG + Intronic
1057600043 9:96450116-96450138 GGCGGACGGCGGCGGCGCCGCGG + Intergenic
1057600070 9:96450176-96450198 GGAGGGCGGTGGCGGCGGAGCGG + Intergenic
1057708076 9:97412146-97412168 AGTGGGCGGCGGCCGCGGCGGGG + Exonic
1058053230 9:100427082-100427104 GGAGGCCGGCGGCCGCAGCTCGG + Intergenic
1058618778 9:106862452-106862474 GGAGCGCGGCCGCCGGGCCGAGG - Intergenic
1058937188 9:109780220-109780242 GGCCGGCGGCGGCGGCGACCGGG + Intronic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059123347 9:111661771-111661793 GGAGGCCGGCGGCCCGGACCGGG + Intronic
1059208398 9:112487190-112487212 TGTGGGGGGCGGCCGCGCCGGGG + Exonic
1059470932 9:114504711-114504733 GGCGGGCGGCGGCGGGGGCGCGG - Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1061128245 9:128689843-128689865 GCAGCGCGGCCGCCGCGGCGCGG - Intronic
1061141776 9:128771776-128771798 GGAGGGAGGGGGTCGCGACGGGG + Exonic
1061248420 9:129413382-129413404 GGCGGGCGGGGGCCGGGGCGGGG - Intergenic
1061281029 9:129597670-129597692 GGAGGGCTGGGGACGCCACGAGG + Intergenic
1061497226 9:130981930-130981952 GGAGGGCGGGGGCCGCAGGGAGG - Intergenic
1062022590 9:134326490-134326512 GGCGCGCGGAGGCCGCGGCGCGG - Intronic
1062084519 9:134641872-134641894 GCGGGGCGGCGGCGGCGAGGAGG + Exonic
1062289041 9:135786393-135786415 GCCGGGCGGCGGCCGCGGAGTGG + Exonic
1062337556 9:136078966-136078988 GGAGAGGGGCGGCGGCGGCGCGG - Intronic
1062478052 9:136739169-136739191 GGAGGGTGGCGGCGGCGTGGAGG + Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062584091 9:137241339-137241361 TGATGGCGGCGGCGGCGGCGGGG - Exonic
1062596433 9:137301970-137301992 CGCGGGCGGCGGCTGCGGCGCGG + Exonic
1062651165 9:137578577-137578599 GGAGGGCGGGGCCGGCCACGAGG - Intronic
1062653424 9:137590118-137590140 TGCGGGCGGCGGCCGGGGCGGGG - Intronic
1062698715 9:137888333-137888355 GGAGGGCAGAGGCAGTGACGTGG - Intronic
1185505691 X:631077-631099 GGAGGGCGGCGGCCACTGCCCGG + Exonic
1185747461 X:2584174-2584196 GGAGGGCGGGGGGCGCGCGGGGG + Intergenic
1185761322 X:2691462-2691484 GGAGGGCGCGGGCCGGGACTGGG + Intronic
1185877682 X:3713521-3713543 GGAAGGCGGGGGCCGCGGCCCGG + Exonic
1185894250 X:3843806-3843828 GGAAGGCGGGGGCCGCGGCCCGG + Exonic
1185899369 X:3882230-3882252 GGAAGGCGGGGGCCGCGGCCCGG + Intergenic
1185904486 X:3920659-3920681 GGAAGGCGGGGGCCGCGGCCCGG + Intergenic
1186107933 X:6226783-6226805 GGAGGGCGCAGGCCGGGACCTGG + Intronic
1186441904 X:9593849-9593871 GGAGGGAGGTGGGCCCGACGAGG - Intronic
1186480820 X:9895175-9895197 GGAGGGTGTCGGCCGCTATGAGG - Exonic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1188004083 X:25005488-25005510 GAAGGGCGGCCGCGGCGGCGCGG - Intronic
1189323073 X:40097811-40097833 GGCGGGCGGCGGCGGCGGAGGGG - Intronic
1189988471 X:46574024-46574046 ATTGGACGGCGGCCGCGACGGGG + Exonic
1190337285 X:49270082-49270104 AGATGGCGGCGGCGGCGGCGGGG + Exonic
1190554279 X:51618141-51618163 GGAGGTCGGCGGTGGCGACCCGG - Intergenic
1190560574 X:51682099-51682121 GGAGGTCGGCGGTGGCGACCCGG - Intergenic
1190563717 X:51711222-51711244 GGAGGTCGGCGGTGGCGACCCGG + Intergenic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1197226544 X:123961096-123961118 GGAGGGCGGGGGGCGCCGCGGGG - Intronic
1198100436 X:133417349-133417371 GGAGGGCGGGGGCGGCGGGGGGG - Intergenic
1198388305 X:136148234-136148256 GGATGGCGGGGGTGGCGACGAGG + Intronic
1200147748 X:153935214-153935236 GGAGGGGGGCTGTCGCGCCGAGG - Exonic
1200163145 X:154019376-154019398 GGAGGCCGGCGGGCCCCACGGGG - Intronic